BOL: Related items

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

ChopStitch: exon annotation and splice graph construction using transcriptome assembly and whole genome sequencing data

Rahul Nayak — Tue, 03 Jul 2018 04:14:52 -0500

ChopStitch is a new method for finding putative exons and constructing splice graphs using an assembled transcriptome and whole genome shotgun sequencing (WGSS) data. ChopStitch identifies exon-exon boundaries in de novo assembled RNA-seq data with the help of a Bloom filter that represents the k-mer spectrum of WGSS reads. The algorithm also detects base substitutions in transcript sequences corresponding to sequencing or assembly errors, haplotype variations, or putative RNA editing events. The primary output of our tool is a FASTA file containing putative exons. Further, exon edges are interrogated for alternative exon-exon boundaries to detect transcript isoforms, which are reported as splice graphs in dot output format.

Address of the bookmark: https://github.com/bcgsc/ChopStitch

Collection of Graph Visualization tools !

Neel — Wed, 25 Jan 2023 02:57:42 -0600

Standard approaches to genome inference and analysis relate sequences to a single linear reference genome. This is efficient but has a fundamental problem: Differences from this reference are hard to observe and describe in a coherent way. Variation and sequence are separated.

https://fungidb.org/fungidb/app/downloads/Current_Release/GultimumBR650/

Address of the bookmark: https://pangenome.github.io/

Many-Core Engine (MCE) for Perl example

Jit — Tue, 31 Jan 2017 05:37:50 -0600

MCE spawns a pool of workers and therefore does not fork a new process per each element of data. Instead, MCE follows a bank queuing model. Imagine the line being the data and bank-tellers the parallel workers. MCE enhances that model by adding the ability to chunk the next n elements from the input stream to the next available worker.

CORE MODULES

Three modules make up the core engine for MCE.

MCE::Core: Provides the Core API for Many-Core Engine. The various MCE options are described here.
MCE::Signal: Temporary directory creation, cleanup, and signal handling.
MCE::Util: Utility functions for Many-Core Engine.

MCE EXTRAS

There are 4 add-on modules for use with MCE.

MCE::Candy: Provides a collection of sugar methods and output iterators for preserving output order.
MCE::Mutex: Provides a simple semaphore implementation supporting threads and processes.
MCE::Queue: Provides a hybrid queuing implementation for MCE supporting normal queues and priority queues from a single module. MCE::Queue exchanges data via the core engine to enable queuing to work for both children (spawned from fork) and threads.
MCE::Relay: Enables workers to receive and pass on information orderly with zero involvement by the manager process while running.

MCE MODELS

The models take Many-Core Engine to a new level for ease of use. Two options (chunk_size and max_workers) are configured automatically as well as spawning and shutdown.

MCE::Loop: Provides a parallel loop utilizing MCE for building creative loops.
MCE::Flow: A parallel flow model for building creative applications. This makes use of user_tasks in MCE. The author has full control when utilizing this model. MCE::Flow is similar to MCE::Loop, but allows for multiple code blocks to run in parallel with a slight change to syntax.
MCE::Grep: Provides a parallel grep implementation similar to the native grep function.
MCE::Map: Provides a parallel map model similar to the native map function.
MCE::Step: Provides a parallel step implementation utilizing MCE::Queue between user tasks. MCE::Step is a spin off from MCE::Flow with a touch of MCE::Stream. This model, introduced in 1.506, allows one to pass data from one sub-task into the next transparently.
MCE::Stream: Provides an efficient parallel implementation for chaining multiple maps and greps together through user_tasks and MCE::Queue. Like with MCE::Flow, MCE::Stream can run multiple code blocks in parallel with a slight change to syntax from MCE::Map and MCE::Grep.

MISCELLANEOUS

Miscellaneous additions included with the distribution.

MCE::Examples: Describes various demonstrations for MCE including a Monte Carlo simulation.
MCE::Subs: Exports functions mapped directly to MCE methods; e.g. mce_wid. The module allows 3 options; :manager, :worker, and :getter.

REQUIREMENTS

Perl 5.8.0 or later. PDL::IO::Storable is required in scripts running PDL.

SOURCE AND FURTHER READING

The source, cookbook, and examples are hosted at GitHub.

CrocoBLAST: Optimized parallel implementation of local sequence alignment algorithms

Jit — Tue, 25 Jul 2017 05:03:10 -0500

Local sequence alignment is a cornerstone of bioinformatics, allowing to compare the amino-acid sequences of different proteins, or the nucleotide sequences of different pieces of DNA. The Basic Local Alignment Search Tool (BLAST) has revolutionized the field of bioinformatics, and is currently implemented in all free and commercial bioinformatics packages. However, with the advent of Next Generation Sequencing (NGS) and the development of new sequencing techniques, the utility of traditional BLAST implementations is limited. CrocoBLAST combines the accuracy and general applicability of BLAST with computational efficiency, accessibility, and user experience, so that NGS data can be analyzed efficiently even when only modest computational resources are available.

https://webchem.ncbr.muni.cz/Platform/App/CrocoBLAST

Address of the bookmark: https://webchem.ncbr.muni.cz/Platform/App/CrocoBLAST

CNIDARIA: fast, reference-free phylogenomic clustering

Shruti Paniwala — Thu, 16 Jun 2016 17:55:17 -0500

Motivation: Identification of biological specimens is a major requirement for a range of applications. Reference-free methods analyse unprocessed sequencing data without relying on prior knowledge, but these do not scale to arbitrarily large genomes and arbitrarily large phylogenetic distances.

Results: We present Cnidaria, a practical tool for clustering genomic and transcriptomic data with no limitation on ge-nome size or phylogenetic distances. We successfully simultaneously clustered 169 genomic and transcriptomic datasets from 4 kingdoms, achieving 100% accuracy at supra-species level and 78% accuracy for species level.

Availability and Implementation: Cnidaria is written in C++ and Python and is available at http://www.ab.wur.nl/cnidaria.

Contact: Saulo Aflitos - sauloal@gmail.com

Supplementary information: Supplementary data are available at Bioinformatics online.

Address of the bookmark: https://github.com/sauloal/cnidaria/wiki

NCBI PSI-BLAST Tutorial

Fri, 23 Aug 2013 02:25:02 -0500

http:--www.biotechnology.jhu.edu- Tutorial for PSI-BLAST, an extension of BLAST that uses matrix algebra. BLAST is a cornerstone bioinformatics tool at NCBI. BLAST is the Basic Local Alignment Search tool and will protein and DNA sequences that are related to a sequence that the user provides.

Efficient genome searching with Biostrings and the BSgenome data package

Aasha — Mon, 07 Mar 2016 05:18:06 -0600

Address of the bookmark: https://www.bioconductor.org/packages/3.3/bioc/vignettes/BSgenome/inst/doc/GenomeSearching.pdf

MetaGraph: Ultra Scalable Framework for DNA Search, Alignment, Assembly

Abhi — Sat, 08 Jun 2024 16:15:25 -0500

The MetaGraph framework is designed to work with a wide range of input data sets, indexing from a few samples up to the contents of entire archives with hundreds of thousands of records. The indexing workflow always follows the same principle, transforming single input samples into error-removed, refined sample graphs, which are then merged into a joint metagraph index. Each input sample is annotated in the joint index as a subgraph. This graph index enriched with metadata can then be used for downstream applications such as sequence search or differential assembly.

Searcg link https://metagraph.ethz.ch/search

Pre-print https://www.biorxiv.org/content/10.1101/2020.10.01.322164v4

Address of the bookmark: https://metagraph.ethz.ch/

MMseqs2.0: ultra fast and sensitive protein search and clustering suite

Jit — Thu, 22 Mar 2018 10:40:51 -0500

MMseqs2 (Many-against-Many sequence searching) is a software suite to search and cluster huge protein sequence sets. MMseqs2 is open source GPL-licensed software implemented in C++ for Linux, MacOS, and (as beta version, via cygwin) Windows. The software is designed to run on multiple cores and servers and exhibits very good scalability. MMseqs2 can run 10000 times faster than BLAST. At 100 times its speed it achieves almost the same sensitivity. It can perform profile searches with the same sensitivity as PSI-BLAST at over 400 times its speed.

The MMseqs2 user guide is available as Github Wiki or as PDF file (Thanks to pandoc!)

Please cite: Steinegger M and Soeding J. MMseqs2 enables sensitive protein sequence searching for the analysis of massive data sets. Nature Biotechnology, doi: 10.1038/nbt.3988 (2017).

Address of the bookmark: https://github.com/soedinglab/MMseqs2