BOL: Related items

The wavefront alignment (WFA) algorithm

BioStar — Sun, 28 Jun 2020 10:17:50 -0500

The wavefront alignment (WFA) algorithm is an exact gap-affine algorithm that takes advantage of
homologous regions between the sequences to accelerate the alignment process. As opposed to traditional dynamic programming algorithms that run in quadratic time, the WFA runs in time O(ns), proportional to the read length n and the alignment score s, using O(s^2) memory. Moreover, the WFA exhibits simple data dependencies that can be easily vectorized, even by the automatic features of modern compilers, for different architectures, without the need to adapt the code.

Address of the bookmark: https://github.com/smarco/WFA

A web-based tool for sequence alignment statistics and innovative visualization

BioStar — Thu, 04 Apr 2024 01:44:50 -0500

AlignStatPlot, a new R package and online tool that is well-documented and easy-to usefor MSA and post-MSA analysis. This tool performs both traditional and cutting-edge analy-ses on sequencing data and generates new visualisation methods for MSA results. Whencompared to currently available tools, AlignStatPlot provides a robust ability to handle andvisualise diversity data, while the online version will save time and encourage researchersto focus on explaining their findings. It is a simple tool that can be used in conjunction withpopulation genetics software (PDF) AlignStatPlot: An R package and online tool for robust sequence alignment statistics and innovative visualization of big data.

Address of the bookmark: https://bioinformatics.um6p.ma/AlignStatPlot/

Alvis: a tool for contig and read ALignment VISualisation and chimera detection

LEGE — Wed, 08 May 2024 07:02:55 -0500

Alvis, a simple command line tool that can generate visualisations for a number of common alignment analysis tasks. Alvis is a fast and portable tool that accepts input in a variety of alignment formats and will output production ready vector images. Additionally, Alvis will highlight potentially chimeric reads or contigs, a common source of misassemblies.

More at https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-021-04056-0

Address of the bookmark: https://github.com/SR-Martin/alvis

FastGT: an alignment-free method for calling common SNVs directly from raw sequencing reads

Jit — Tue, 28 Jan 2020 03:27:33 -0600

FastGT is a program package for whole-genome genotyping of genome variants directly from raw sequencing reads. It is written in C and runs in Linux. FastGT uses a list of variant-specific k-mer pairs that are unique in human genome, counts the frequency of k-mers in sequencing data and predicts the genotype. All this takes less than 1 hour on average low-cost Linux server.

http://bioinfo.ut.ee/FastGT/

https://github.com/bioinfo-ut/GenomeTester4/

Address of the bookmark: http://bioinfo.ut.ee/FastGT/

BBMap/BBTools package: Multipurpose tool designed for converting reads or other nucleotide data between different formats.

Jit — Mon, 13 Jun 2016 05:47:21 -0500

Reformatis a member of the BBMap/BBTools package. It is a multipurpose tool designed for converting reads or other nucleotide data between different formats. It supports, and can inter-convert:

fastq
fasta
fasta+qual
sam
scarf (an old Illumina format)
bam (if samtools is installed)
gzip
zip
ascii-33 (sanger)
ascii-64 (old Illumina)
paired files
interleaved files

It is multithreaded and can process data at over 500 megabytes per second, and can accept streams from standard in and write to standard out, allowing it to be easily dropped into the middle of a pipeline for format conversion. Reformat autodetects formats based on file extensions and content, making it very easy to use; and the autodetection can be overridden, allowing flexibility for people who don't like to follow naming conventions, or out-of-spec fastq files with qualities values like -17 or 120.

The program has been gradually expanded, and can now perform various other functions. None of these will break pairing, if the input is paired.

Quality trimming (either or both ends)
Quality filtering
Fixed-length trimming
Generation of histograms (base composition, quality, etc)
Subsampling (to a fraction of input reads, or an exact number of reads or bases)
Changing fasta line-wrapping length
Reverse-complementing (all reads or only read 2)
Adding /1 and /2 suffix to read names
GC-content filtering
Length-filtering
Testing for corrupted interleaved files

Reformat is compatible with any platform that supports Java 1.7 or higher. It also has a bash shellscript for simpler invocation. Typical usage examples:

Reformat fastq into fasta:
reformat.sh in=x.fq out=y.fa

Interleave paired reads:
reformat.sh in1=x1.fq in2=x2.fq out=y.fq

Note - you can actually use a shortcut if paired read files have the same name with a 1 and a 2. This is equivalent to the above command:
reformat.sh in=x#.fq out=y.fq

De-interleave reads:
reformat.sh in=x.fq out1=y1.fq out2=y2.fq

Verify that interleaving appears correct, assuming Illumina namimg conventions:
reformat.sh in=x.fq vint

Convert ASCII-33 to ASCII-64:
reformat.sh in=x.fq out=y.fq qin=33 qout=64

Quality-trim paired reads to Q10 on the left and right ends and discard reads shorter than 50bp after trimming:
reformat.sh in1=x1.fq in2=x2.fq out1=y1.fq out2=y2.fq outsingle=singletons.fq qtrim=rl trimq=10 minlength=50

Subsample 10% of the first 20000 pairs in an interleaved file:
reformat.sh in=x.fq out=y.fq reads=20000 samplerate=0.1 int=t
(in this case "int=t" overrides interleaving autodetection, to ensure reads are treated as pairs)

Pipe in a gzipped sam file and pipe out fasta:
reformat.sh in=stdin.sam.gz out=stdout.fa

Reverse-complement reads:
reformat.sh in=x.fq out=y.fq rcomp

For reformatting a file with very long sequences, Reformat will need more memory; just add the additional flag "-Xmx2g". For example, to change the line-wrapping length on the human genome (which has individual sequences over 200Mbp long) to 70 characters:
reformat.sh -Xmx2g in=HG19.fa.gz out=HG19_wrapped.fa.gz fastawrap=70

For additional functions, please run the shellscript with no arguments, or just read it with a text editor. If you have any questions, please post them in this thread.

For people using a non-bash terminal, you may need to type "bash reformat.sh" instead of just "reformat.sh".
For users of Windows or other platforms that do not support bash shellscripts, replace "reformat.sh" with "java -ea -Xmx200m /path/to/bbmap/current/ jgi.ReformatReads"
for example,
java -ea -Xmx200m C:\bbmap\current\ jgi.ReformatReads in=x.fq out=y.fa

Reformat can be downloaded with BBTools here:
https://sourceforge.net/projects/bbmap/

Graph Genome Suite

Jit — Fri, 28 Oct 2016 07:59:54 -0500

Seven Bridges is the biomedical data analysis company accelerating breakthroughs in genomics research for cancer, drug development and precision medicine. We build self-improving systems to analyze millions of genomes, including the Graph Genome Suite — the most advanced population genomics tools in the world.

Address of the bookmark: https://www.sbgenomics.com/graph/

Rectangle Graph for Repeat Resolution in Genome Assembly

Rahul Nayak — Thu, 28 Dec 2017 09:43:03 -0600

Ultimate tool for resolving repeats in genome assemblies.

Though the specific implementation of the idea of the rectangle graph approach is already included into the current SPAdes distribution, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.

For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner. From de Bruijn Graphs to Rectangle Graphs for Genome Assembly, Lecture Notes in Bioinformatics 7534 (2012), pp. 249-261.

Address of the bookmark: http://bioinf.spbau.ru/en/rectangles

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph

Jit — Wed, 14 Nov 2018 04:50:27 -0600

MEGAHIT is a single node assembler for large and complex metagenomics NGS reads, such as soil. It makes use of succinct de Bruijn graph (SdBG) to achieve low memory assembly. MEGAHIT can optionally utilize a CUDA-enabled GPU to accelerate its SdBG contstruction. The GPU-accelerated version of MEGAHIT has been tested on NVIDIA GTX680 (4G memory) and Tesla K40c (12G memory) with CUDA 5.5, 6.0 and 6.5. MEGAHIT v1.0 or greater also supports IBM Power PC and has been tested on IBM POWER8.

https://academic.oup.com/bioinformatics/article/31/10/1674/177884

Address of the bookmark: https://github.com/voutcn/megahit

JumboDB: tool for de Bruijn graph construction

BioStar — Tue, 17 Aug 2021 13:33:46 -0500

jumboDB tool for fast de Bruijn graph construction from long sequences (reads or genomes) with very low error rate. JumboDB is not a genome assembler by itself but rather a subroutine that translates a set of reads into compressed de Bruijn graph.

More at https://github.com/AntonBankevich/jumboDB

Address of the bookmark: https://github.com/AntonBankevich/jumboDB