BOL: Related items

Alvis: a tool for contig and read ALignment VISualisation and chimera detection

LEGE — Wed, 08 May 2024 07:02:55 -0500

Alvis, a simple command line tool that can generate visualisations for a number of common alignment analysis tasks. Alvis is a fast and portable tool that accepts input in a variety of alignment formats and will output production ready vector images. Additionally, Alvis will highlight potentially chimeric reads or contigs, a common source of misassemblies.

More at https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-021-04056-0

Address of the bookmark: https://github.com/SR-Martin/alvis

FastGT: an alignment-free method for calling common SNVs directly from raw sequencing reads

Jit — Tue, 28 Jan 2020 03:27:33 -0600

FastGT is a program package for whole-genome genotyping of genome variants directly from raw sequencing reads. It is written in C and runs in Linux. FastGT uses a list of variant-specific k-mer pairs that are unique in human genome, counts the frequency of k-mers in sequencing data and predicts the genotype. All this takes less than 1 hour on average low-cost Linux server.

http://bioinfo.ut.ee/FastGT/

https://github.com/bioinfo-ut/GenomeTester4/

Address of the bookmark: http://bioinfo.ut.ee/FastGT/

BBMap/BBTools package: Multipurpose tool designed for converting reads or other nucleotide data between different formats.

Jit — Mon, 13 Jun 2016 05:47:21 -0500

Reformatis a member of the BBMap/BBTools package. It is a multipurpose tool designed for converting reads or other nucleotide data between different formats. It supports, and can inter-convert:

fastq
fasta
fasta+qual
sam
scarf (an old Illumina format)
bam (if samtools is installed)
gzip
zip
ascii-33 (sanger)
ascii-64 (old Illumina)
paired files
interleaved files

It is multithreaded and can process data at over 500 megabytes per second, and can accept streams from standard in and write to standard out, allowing it to be easily dropped into the middle of a pipeline for format conversion. Reformat autodetects formats based on file extensions and content, making it very easy to use; and the autodetection can be overridden, allowing flexibility for people who don't like to follow naming conventions, or out-of-spec fastq files with qualities values like -17 or 120.

The program has been gradually expanded, and can now perform various other functions. None of these will break pairing, if the input is paired.

Quality trimming (either or both ends)
Quality filtering
Fixed-length trimming
Generation of histograms (base composition, quality, etc)
Subsampling (to a fraction of input reads, or an exact number of reads or bases)
Changing fasta line-wrapping length
Reverse-complementing (all reads or only read 2)
Adding /1 and /2 suffix to read names
GC-content filtering
Length-filtering
Testing for corrupted interleaved files

Reformat is compatible with any platform that supports Java 1.7 or higher. It also has a bash shellscript for simpler invocation. Typical usage examples:

Reformat fastq into fasta:
reformat.sh in=x.fq out=y.fa

Interleave paired reads:
reformat.sh in1=x1.fq in2=x2.fq out=y.fq

Note - you can actually use a shortcut if paired read files have the same name with a 1 and a 2. This is equivalent to the above command:
reformat.sh in=x#.fq out=y.fq

De-interleave reads:
reformat.sh in=x.fq out1=y1.fq out2=y2.fq

Verify that interleaving appears correct, assuming Illumina namimg conventions:
reformat.sh in=x.fq vint

Convert ASCII-33 to ASCII-64:
reformat.sh in=x.fq out=y.fq qin=33 qout=64

Quality-trim paired reads to Q10 on the left and right ends and discard reads shorter than 50bp after trimming:
reformat.sh in1=x1.fq in2=x2.fq out1=y1.fq out2=y2.fq outsingle=singletons.fq qtrim=rl trimq=10 minlength=50

Subsample 10% of the first 20000 pairs in an interleaved file:
reformat.sh in=x.fq out=y.fq reads=20000 samplerate=0.1 int=t
(in this case "int=t" overrides interleaving autodetection, to ensure reads are treated as pairs)

Pipe in a gzipped sam file and pipe out fasta:
reformat.sh in=stdin.sam.gz out=stdout.fa

Reverse-complement reads:
reformat.sh in=x.fq out=y.fq rcomp

For reformatting a file with very long sequences, Reformat will need more memory; just add the additional flag "-Xmx2g". For example, to change the line-wrapping length on the human genome (which has individual sequences over 200Mbp long) to 70 characters:
reformat.sh -Xmx2g in=HG19.fa.gz out=HG19_wrapped.fa.gz fastawrap=70

For additional functions, please run the shellscript with no arguments, or just read it with a text editor. If you have any questions, please post them in this thread.

For people using a non-bash terminal, you may need to type "bash reformat.sh" instead of just "reformat.sh".
For users of Windows or other platforms that do not support bash shellscripts, replace "reformat.sh" with "java -ea -Xmx200m /path/to/bbmap/current/ jgi.ReformatReads"
for example,
java -ea -Xmx200m C:\bbmap\current\ jgi.ReformatReads in=x.fq out=y.fa

Reformat can be downloaded with BBTools here:
https://sourceforge.net/projects/bbmap/

Graph Genome Suite

Jit — Fri, 28 Oct 2016 07:59:54 -0500

Seven Bridges is the biomedical data analysis company accelerating breakthroughs in genomics research for cancer, drug development and precision medicine. We build self-improving systems to analyze millions of genomes, including the Graph Genome Suite — the most advanced population genomics tools in the world.

Address of the bookmark: https://www.sbgenomics.com/graph/

Rectangle Graph for Repeat Resolution in Genome Assembly

Rahul Nayak — Thu, 28 Dec 2017 09:43:03 -0600

Ultimate tool for resolving repeats in genome assemblies.

Though the specific implementation of the idea of the rectangle graph approach is already included into the current SPAdes distribution, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.

For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner. From de Bruijn Graphs to Rectangle Graphs for Genome Assembly, Lecture Notes in Bioinformatics 7534 (2012), pp. 249-261.

Address of the bookmark: http://bioinf.spbau.ru/en/rectangles

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

ChopStitch: exon annotation and splice graph construction using transcriptome assembly and whole genome sequencing data

Rahul Nayak — Tue, 03 Jul 2018 04:14:52 -0500

ChopStitch is a new method for finding putative exons and constructing splice graphs using an assembled transcriptome and whole genome shotgun sequencing (WGSS) data. ChopStitch identifies exon-exon boundaries in de novo assembled RNA-seq data with the help of a Bloom filter that represents the k-mer spectrum of WGSS reads. The algorithm also detects base substitutions in transcript sequences corresponding to sequencing or assembly errors, haplotype variations, or putative RNA editing events. The primary output of our tool is a FASTA file containing putative exons. Further, exon edges are interrogated for alternative exon-exon boundaries to detect transcript isoforms, which are reported as splice graphs in dot output format.

Address of the bookmark: https://github.com/bcgsc/ChopStitch

GraphUnzip: Phases an assembly graph using Hi-C data and/or long reads.

Jit — Fri, 05 Feb 2021 21:22:24 -0600

GraphUnzip, a fast, memory-efficient and accurate tool to unzip assembly graphs into their constituent haplotypes using long reads and/or Hi-C data. As GraphUnzip only connects sequences in the assembly graph that already had a potential link based on overlaps, it yields high-quality gap-less supercontigs. To demonstrate the efficiency of GraphUnzip, we tested it on a simulated diploid Escherichia coli genome, and on two real datasets for the genomes of the rotifer Adineta vaga and the potato Solanum tuberosum. In all cases, GraphUnzip yielded highly continuous phased assemblies.

https://www.biorxiv.org/content/biorxiv/early/2021/02/01/2021.01.29.428779.full.pdf

Address of the bookmark: https://github.com/nadegeguiglielmoni/GraphUnzip

GraphPath: A graph attention model for molecular stratification with interpretability based on the pathway-pathway interaction network

LEGE — Wed, 27 Mar 2024 20:51:21 -0500

Achieving accurate and interpretable clinical predictions requires paramount attention to thoroughly characterizing patients at both the molecular and biological pathway levels. In this paper, we present GraphPath, a biological knowledge-driven graph neural network with multi-head self-attention mechanism that implements the pathway-pathway interaction network. We train GraphPath to classify the cancer status of patients with prostate cancer based on their multi-omics profiling.

Address of the bookmark: https://github.com/amazingma/GraphPath

Step-by-Step Guide to Running Genome Assembly

Abhi — Fri, 13 Dec 2024 11:35:55 -0600

Genome assembly is a critical process in bioinformatics, enabling the reconstruction of an organism's genome from short DNA sequence reads. Whether you’re working on a new microbial genome or a complex eukaryotic organism, this guide will walk you through the steps of genome assembly using state-of-the-art tools and best practices.

What is Genome Assembly?

Genome assembly involves piecing together short DNA sequence reads generated by sequencing platforms (e.g., Illumina, PacBio, Oxford Nanopore) into longer, contiguous sequences called contigs. This can be performed as:

De Novo Assembly: Without a reference genome.
Reference-Guided Assembly: Using a reference genome to guide the assembly process.

Step 1: Preparing Your Data

Before starting the assembly, ensure that your raw sequencing data is high quality.

Input Data
- Short Reads: Illumina sequencing generates short, accurate reads ideal for scaffolding.
- Long Reads: PacBio and Nanopore sequencing provide long reads for resolving repetitive regions.
Quality Control (QC)
Use tools like FastQC or MultiQC to assess the quality of your reads:

fastqc reads.fastq multiqc .

Look for issues like low-quality bases, adapter contamination, or overrepresented sequences.
Read Trimming and Filtering
Trim low-quality bases and adapters using Trimmomatic or Cutadapt:

trimmomatic PE reads_R1.fastq reads_R2.fastq trimmed_R1.fastq trimmed_R2.fastq \ ILLUMINACLIP:adapters.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:20 MINLEN:36

Step 2: Choosing an Assembly Strategy

Select an assembly strategy based on your data type:

Short-Read Assemblers:
- SPAdes: Popular for microbial genomes.
- Velvet: Fast for smaller genomes.
Long-Read Assemblers:
- Canu: Ideal for long-read datasets.
- Flye: Versatile for small and large genomes.
Hybrid Assemblers:
- MaSuRCA: Combines short and long reads.
- Unicycler: Optimized for bacterial genomes.

Step 3: Running the Assembly

3.1. SPAdes (Short-Read Assembly)

SPAdes is an excellent choice for small genomes, such as bacteria.

spades.py -1 trimmed_R1.fastq -2 trimmed_R2.fastq -o spades_output

The output includes assembled contigs (contigs.fasta) and scaffolds (scaffolds.fasta).

3.2. Canu (Long-Read Assembly)

Canu is designed for high-error long reads from PacBio or Nanopore.

canu -p genome -d canu_output genomeSize=4.7m -nanopore-raw reads.fastq

The output will be in canu_output/genome.contigs.fasta.

3.3. Hybrid Assembly with Unicycler

Unicycler combines short and long reads for improved assemblies.

unicycler -1 trimmed_R1.fastq -2 trimmed_R2.fastq -l long_reads.fastq -o unicycler_output

Step 4: Assessing Assembly Quality

After assembly, evaluate its quality using the following tools:

QUAST
QUAST generates assembly statistics, such as N50, genome size, and GC content:

quast contigs.fasta -o quast_output
BUSCO
BUSCO checks genome completeness by identifying conserved genes:

busco -i contigs.fasta -o busco_output -l fungi_odb10 -m genome
Assembly Graph Visualization
Visualize assembly graphs with Bandage:

Bandage load assembly_graph.gfa

Step 5: Post-Assembly Steps

Polishing
Improve assembly accuracy using tools like Pilon (for short reads) or Racon (for long reads).

racon long_reads.fasta mapped_reads.sam contigs.fasta > polished_contigs.fasta
Scaffolding
Link contigs into scaffolds using tools like SSPACE or Opera-LG if required.
Annotation
Annotate the assembled genome using Prokka for prokaryotes or Maker for eukaryotes.

prokka --outdir annotation_output --prefix genome contigs.fasta

Step 6: Sharing and Archiving

Submit to Public Repositories
Share your assembly in databases like NCBI GenBank, ENA, or DDBJ.
Metadata Preparation
Include detailed metadata for your submission, such as organism name, sequencing platform, and coverage.

Best Practices

Always perform quality checks at each stage to ensure data integrity.
Use multiple tools to cross-validate results when working with complex genomes.
Document parameters and software versions for reproducibility.

Conclusion

Genome assembly is a powerful process that transforms raw sequencing data into a coherent representation of an organism’s genome. By following this step-by-step guide, you can successfully assemble genomes and uncover valuable biological insights. Whether you’re assembling a microbial genome or tackling the complexities of a eukaryotic genome, these tools and strategies will set you on the path to success.