<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/40754?offset=30</link>
	<atom:link href="https://bioinformaticsonline.com/related/40754?offset=30" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44614/online-resources-on-must-read-papers-in-evolutionary-biology</guid>
	<pubDate>Fri, 26 Jul 2024 01:39:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44614/online-resources-on-must-read-papers-in-evolutionary-biology</link>
	<title><![CDATA[Online resources on must-read papers in evolutionary biology]]></title>
	<description><![CDATA[<pre>Online resources on must-read papers in evolutionary biology, for a literature club.<br /><br />Below is a summary of all answers that we received.

All the best,

Jana and Xiaoyan

1.       *Nick Barton:*

- The textbook "Evolution" by Nick Barton, with resources for
  exploring the literature: Barton, N. H., Briggs, D. E. G., Eisen, J.
  A., Goldstein, D. B., &amp; Patel, N. H. (2007). Evolution. Cold Spring
  Harbor Laboratory Press.

- Papers from a course named "Classics in Evolutionary Biology":

Evolutionary Synthesis
1. Haldane, J. B. S. 1932. The causes of evolution. Longmans. New York.
   (esp. Ch. IV).
2. Fisher, R. A. 1930. The genetical theory of natural selection. Oxford
   University Press, Oxford. Selected Sections - Fundamental Theorem.

Genetic Variation
1a. Lewontin, R. C., and J. L. Hubby. 1966. A molecular approach to
the study of genic heterozygosity in natural populations. II. Amount
of variation and degree of heterozygosity in natural populations of
Drosophila pseudoobscura. Genetics. 54:595-609.

1b. Sachidandam et al. 2001. A map of human genome sequence variation
containing 1.42 million single nucleotide polymorphisms. 409: 928-33.

2. Wright S., Dobzhansky T., Hovanitz W. 1942 Genetics of natural
populations VII The allelism of lethals in the third chromosome of
Drosophila pseudoobscura. Genetics 27: 363-394.

Recombination and evolution
1. Hill, W. G., and A. Robertson. 1966. The effect of linkage on limits
to artificial selection. Genet. Res. 8:269-294.

2. Maynard Smith and Haigh. 1974. The hitch-hiking effect of a favourable
gene. Genet. Res. 23: 23-35.

Understanding sequence variation
1. Begun D. J., Aquadro C. F., 1992 Levels of naturally occurring DNA
polymorphism correlate with recombination rate in Drosophila melanogaster.
Nature 356: 519-520.

2. Green R. E., Reich D., P&auml;&auml;bo S., 2010 A draft sequence of the
Neandertal genome. Science 328: 710-722.

Quantitative Genetics:  variation in complex traits
1. Galton F., 1877 Typical laws of heredity. Nature 15: 492-495-
512-514- 532-533.

2. Turelli M., 1984 Heritable genetic variation via
mutation-selection balance: Lerch's Zeta meets the abdominal
bristle. Theor. Popul. Biol. 25: 138-193.

Quantitative Genetics:  finding the genes
1. Shrimpton A. E., Robertson A., 1988 The Isolation of polygenic factors
controlling bristle score in Drosophila melanogaster II Distribution of
third chromosome bristle effects within chromosome sections. Genetics
118: 445-459.

2. Boyle E. A., Li Y. I., Pritchard J. K., 2017 An expanded view of
complex traits: from polygenic to omnigenic. Cell 169: 1177-1186.

Neutral Evolution
1. Kimura, M. 1968. Evolutionary rate at the molecular level. Science.
217:624-626.

2a. Kern A. D., Hahn M. W., 2018 The Neutral Theory in Light of Natural
Selection. Molecular Biology and Evolution 110: 21077-6.

2b. Jensen J. D., Payseur B. A., Stephan W., Aquadro C. F., Lynch M.,
Charlesworth D., Charlesworth B., 2018 The importance of the Neutral Theory
in 1968 and 50 years on: a response to Kern and Hahn 2018. Evolution 112:
2109-4.

2c. Ellegren &amp; Galtier. 2016. Determinants of genetic diversity. Nature
Reviews Genetics.

Mutation and Genetic Variability
1. Luria, S. E., and M. Delbr&uuml;ck. 1943. Mutations of Bacteria from Virus
Sensitivity to Virus Resistance. Genetics. 28(6):491-511.

2. Hill, W G. 1982. "Rates of Change in Quantitative Traits From Fixation
of New Mutations." Proceedings of the National Academy of Sciences (U.S.A.)
79: 142-45.

Testing for selection
1. McDonald &amp; Kreitman. 1991. Adaptive protein evolution at the Adh locus
in Drosophila. Nature.

2. Begun, et al. Mol. Biol. Evol. 16, 1816-1819 (1999).

3. Siddiq et al. 2016. Experimental test and refutation of a classic case
of molecular adaptation in Drosophila melanogaster.  Nature Ecology &amp;
Evolution.

The shifting balance
1. Wright, S. 1932. The roles of mutation, inbreeding, crossbreeding and
selection in evolution. Proceedings of the VI International Congress of
Genetics: 1. pp 356-366.

2. Coyne, J.A., N.H. Barton, and M. Turelli. 1997. A critique of Wright's
shifting balance theory of evolution.  Evolution 51: 643-671.

3. Barton. 2016. Sewall Wright on Evolution in Mendelian Populations and
the "Shifting Balance". Genetics.

Evolution of Sex
1.  Muller, H.J. 1964. The relation of recombination to mutational advance.
Mutation Res. 1(1):2-9

2. McDonald et al. 2016. Sex speeds adaptation by altering the dynamics of
molecular evolution. Nature.

Kin Selection, Cooperation, and Conflict
1. Hamilton, W. D. 1964. The genetical evolution of social behaviour I.
Journal of Theoretical Biology. 7:1-52.

2. Trivers, R. L. 1974 Parent-offspring conflict. American Zoologist.
14(1):249-264.

Sexual Selection
1. Zahavi, A. 1975. Mate selection - a selection of a handicap. J. Theor.
Biol. 53:205-214.

2. Kirkpatrick, M., and Ryan, M.J. 1991. The evolution of mating
preferences and the paradox of the lek. Nature. 350:33-38.

Fitness Landscapes
1. Dean, A. 1995. A Molecular Investigation of Genotype by Environment
Interactions. Genetics. 139:19-33.

2. Costanzo et al. 2010. The Genetic Landscape of a Cell. Science.

Speciation
1. Coyne, J. A., and H. A. Orr. 1989. Patterns of speciation in Drosophila.
Evolution. 43:362-381.

2. Corbett-Detig et al. 2013. Genetic incompatibilities are widespread
within species. Nature.

2.       *Marcos Antezana:*

Valen, L. v. 1975. Energy and Evolution. University of Chicago, Department
of Biology.

3.       *Remco Folkertsma:*

1. The work by Hopi Hoekstra on local adaptation and oldfield mice

2. Poelstra, J. W., Vijay, N., Bossu, C. M., Lantz, H., Ryll, B., M&uuml;ller,
I., ... &amp; Wolf, J. B. (2014). The genomic landscape underlying phenotypic
integrity in the face of gene flow in crows. Science, 344(6190), 1410-1414.

4.       *Joshka Kaufmann and Leslie Turner*

They offer us a link to 'papers every evolutionary biologist should read',
the papers are collected by Leslie Turner.
https://static1.squarespace.com/static/53e8cb7ce4b02c4bc3aeeee4/t/5ab8fcb670a6ad55c67fcdf4/1522072758665/EvoBioClassicsRefList.pdf

5.       *Sarah Stockwell*

Matt Ridley collected classic papers in evolutionary biology and printed
part of these papers in his book Evolution (see Matt Ridley. Evolution
(Univ. of Oxford Press, 2nd edition, 2004))
</pre>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43042/bioinformatics-in-thailand</guid>
	<pubDate>Wed, 28 Apr 2021 02:04:56 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43042/bioinformatics-in-thailand</link>
	<title><![CDATA[Bioinformatics in Thailand !]]></title>
	<description><![CDATA[<p>Our international PhD and master programs are designed for students who desire focused training in the elements of biology, computer science, and information technology needed for a successful career in the exciting new discipline of Bioinformatics &amp; Systems Biology. Students in our program will receive comprehensive training in omics analysis, database design and management, software engineering and programming (including web-based development), simulation techniques and modeling, and data integration. Each student will apply their skills to a practical project, where they will design and implement a solution to a real-world problem under the guidance of an experienced mentor in industry or academia.</p>
<p><strong>https://bioinformatics.kmutt.ac.th/about.html</strong></p>
<p>Duangrudee Tanramluk (Ajarn Wi) uses computational biology and machine learning to tackle the key to drug design problems via MANORAA webserver.</p>
<p><strong>https://mb.mahidol.ac.th/en/bioinformatics/</strong></p>
<p><strong>https://graduate.mahidol.ac.th/inter/</strong></p>
<p>This&nbsp;international&nbsp;Doctorate programme is designed to further broaden students&rsquo; knowledge in Bioinformatics and Molecular Biology to their maximum capability.&nbsp;</p>
<p><strong>http://www.mbb.psu.ac.th/programmes/phd</strong></p>
<p>Ph.D. program in Bioinformatics and Computational Biology is a joint effort of the Faculty of Science and Faculty of Medicine, Chulalongkorn University. The program has study plans for both applicants who hold a bachelor&rsquo;s degree and applicants who hold a master&rsquo;s degree in any related fields of study.</p>
<p><strong>http://www.bioinfo.sc.chula.ac.th/ph-d-program-specialization/</strong></p>
<p>Additional detail&nbsp;</p>
<p><strong>https://www.biotec.or.th/en/index.php/research/research-units/genome-technology-research-unit</strong></p>
<p><strong>https://tbrcnetwork.org/labtbrc/index.php/bioinformatics-and-chemoinformatics/</strong></p>
<p><strong>https://genomicsthailand.com/Genomic/home</strong></p><p>Address of the bookmark: <a href="https://bioinformatics.kmutt.ac.th/" rel="nofollow">https://bioinformatics.kmutt.ac.th/</a></p>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43552/understanding-pango-networks</guid>
	<pubDate>Sat, 16 Oct 2021 14:02:36 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43552/understanding-pango-networks</link>
	<title><![CDATA[Understanding pango networks !]]></title>
	<description><![CDATA[<p><span>In the vast majority of instances it is expected that Pango lineage names and designations will conform to the following rules. These rules also act as guidelines for the decisions made by the Lineage Designation Committee.</span></p>
<p>https://www.pango.network/the-pango-nomenclature-system/statement-of-nomenclature-rules/</p>
<p>https://www.pango.network/how-does-the-system-work/what-are-pango-lineages/</p>
<p>Reference paper</p>
<p>https://www.nature.com/articles/s41564-020-0770-5</p><p>Address of the bookmark: <a href="https://www.pango.network/the-pango-nomenclature-system/statement-of-nomenclature-rules/" rel="nofollow">https://www.pango.network/the-pango-nomenclature-system/statement-of-nomenclature-rules/</a></p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44279/bioinformatics-training-material</guid>
	<pubDate>Sat, 18 Mar 2023 11:26:18 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44279/bioinformatics-training-material</link>
	<title><![CDATA[Bioinformatics Training Material !]]></title>
	<description><![CDATA[<p><span>Glittr</span>&nbsp;is a curated list of bioinformatics training material.<br>All material is:</p>
<ul>
<li>In a GitHub or GitLab repository</li>
<li>Free to use</li>
<li>Written in markdown or similar</li>
</ul>
<p><span>NOTE:</span>&nbsp;This list of courses is selected only based on the above criteria.<br>There are no checks on quality.</p>
<p>https://glittr.org/?per_page=25&amp;sort_by=stargazers&amp;sort_direction=desc</p><p>Address of the bookmark: <a href="https://glittr.org/?per_page=25&amp;sort_by=stargazers&amp;sort_direction=desc" rel="nofollow">https://glittr.org/?per_page=25&amp;sort_by=stargazers&amp;sort_direction=desc</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/2042/ngs-course-medical-genomics-scheduled-for-17-20-september-2013-in-uz-leuven-belgium</guid>
	<pubDate>Mon, 12 Aug 2013 12:08:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/2042/ngs-course-medical-genomics-scheduled-for-17-20-september-2013-in-uz-leuven-belgium</link>
	<title><![CDATA[NGS course Medical Genomics, scheduled for 17-20 September 2013 in UZ Leuven (Belgium).]]></title>
	<description><![CDATA[<p>This course is open to all students and postdocs and registration for all academic participants is free of charge. To help us in organizing the course, please register online via http://gc.uzleuven.be where the preliminary program is also available.</p><p>This course is organized with support from the IAP &ldquo;Belgian Medical Genomics Initiative&rdquo;, SymBioSys and the Genomics Core.</p><p>For inquiries, please email Ms Narcisse Opdekamp ( narcisse.opdekamp@uzleuven.be ).</p><p>More at &gt;&gt;&nbsp;<a href="http://gc.uzleuven.be/">http://gc.uzleuven.be/</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/7674/useful-publications-and-websites-for-deep-sequencing-data-analysis</guid>
	<pubDate>Sun, 29 Dec 2013 22:30:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/7674/useful-publications-and-websites-for-deep-sequencing-data-analysis</link>
	<title><![CDATA[Useful Publications and Websites for Deep Sequencing Data Analysis]]></title>
	<description><![CDATA[<h3>Global overview papers</h3><p>Next generation quantitative genetics in plants. Jim&eacute;nez-G&oacute;mez, Frontiers in Plant Science 2:77, 2011 <span style="text-decoration: underline;"><a href="http://www.frontiersin.org/Plant_Physiology/10.3389/fpls.2011.00077/full">Full Text</a> </span><em>[equally relevant to animal and microbial systems]</em></p><p>Sense from sequence reads: methods for alignment and assembly. Flicek &amp; Birney, Nat Methods 6(11 Suppl):S6-S12, 2009. <a href="http://www.nature.com/nmeth/journal/v6/n11s/full/nmeth.1376.html"><span style="text-decoration: underline;">Full Text</span></a></p><h3>Library construction and experimental design</h3><p>Statistical design and analysis of RNA sequencing data. Auer &amp; Doerge, Genetics 185(2):405-16, 2010. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2881125"><span style="text-decoration: underline;">PubMedCentral</span></a></p><p>Biases in Illumina transcriptome sequencing caused by random hexamer priming. Hansen et al., Nucleic Acids Res. 38(12): e131, 2010. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2896536"><span style="text-decoration: underline;">PubMedCentral</span></a></p><p>Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Aird et al, Genome Biology 12:R18, 2011 <a href="http://genomebiology.com/2011/12/2/R18"><span style="text-decoration: underline;">Full Text</span></a></p><p>Amplification-free Illumina sequencing-library preparation facilitates improved mapping and assembly of GC-biased genomes. Kozarewa et al, Nature Methods 6(4):291-5, 2009 <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2664327/"><span style="text-decoration: underline;">PubMedCentral</span></a></p><p>Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Rohland &amp; Reich, Genome Research 22(5): 939&ndash;946. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3337438/"><span style="text-decoration: underline;">PubMedCentral</span></a></p><h3>Data formats, data management, and alignment software tools<span style="text-decoration: underline;"> </span></h3><p>The Sequence Alignment/Map format and SAMtools. Li et al, Bioinformatics 25(16):2078-9, 2009 <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2723002"><span style="text-decoration: underline;">PubMedCentral</span></a></p><p>SAM format specification <a href="http://samtools.sourceforge.net/SAM1.pdf"><span style="text-decoration: underline;">file</span></a></p><p>Efficient storage of high throughput sequencing data using reference-based compression. Fritz et al, Genome Res 21(5):734-40, 2011. <a href="http://genome.cshlp.org/content/21/5/734.long"><span style="text-decoration: underline;">Full Text</span></a></p><p>Compression of DNA sequence reads in FASTQ format. Deorowicz &amp; Grabowski, Bioinformatics 27(6):860-2, 2011. <a href="http://www.ncbi.nlm.nih.gov/pubmed/21252073"><span style="text-decoration: underline;">PubMed</span></a></p><p>Fast and accurate short read alignment with Burrows-Wheeler transform. Li &amp; Durbin, Bioinformatics 25(14):1754-60, 2009. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2705234"><span style="text-decoration: underline;">PubMedCentral</span></a></p><p>Improving SNP discovery by base alignment quality. Li H, Bioinformatics 27(8):1157-8, 2011. <a href="http://www.ncbi.nlm.nih.gov/pubmed/21320865"><span style="text-decoration: underline;">PubMed</span></a></p><p>BEDTools: a flexible suite of utilities for comparing genomic features. Quinlan and Hall, Bioinformatics 26:841-842, 2010. <a href="http://bioinformatics.oxfordjournals.org/content/26/6/841.full.pdf+html"><span style="text-decoration: underline;">Publisher Website</span></a></p><h3>Data quality assessment, filtering, and correction</h3><p>SolexaQA: At-a-glance quality assessment of Illumina second-generation sequencing data. Cox et al, BMC Bioinformatics 11:485, 2010. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2956736"><span style="text-decoration: underline;">PubMedCentral</span></a></p><p>TileQC: a system for tile-based quality control of Solexa data. Dolan &amp; Denver, BMC Bioinformatics 9:250, 2008 <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2443380"><span style="text-decoration: underline;">PubMedCentral</span></a> <em>[requires a reference sequence]</em></p><p>Quake: quality-aware detection and correction of sequencing errors. Kelley et al, Genome Biol 11(11):R116, 2010. <a href="http://www.ncbi.nlm.nih.gov/pubmed/21114842"> <span style="text-decoration: underline;">PubMed</span></a></p><p>FastQC: a quality control tool for high-throughput sequence data. <a href="http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/"><span style="text-decoration: underline;">Home Page</span></a></p><p>FASTX-toolkit: FASTQ/A short-reads pre-processing tools <a href="http://hannonlab.cshl.edu/fastx_toolkit/"><span style="text-decoration: underline;">Home Page</span></a></p><p>Reference-free validation of short read data. Schr&ouml;der et al, PLoS One 5(9):e12681, 2010. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2943903"> <span style="text-decoration: underline;">PubMedCentral</span></a></p><p>Correction of sequencing errors in a mixed set of reads. Salmela, Bioinformatics 26(10):1284, 2010. <a href="http://bioinformatics.oxfordjournals.org/content/26/10/1284.long"><span style="text-decoration: underline;">Full Text</span></a> <em>[includes error correction of SOLiD reads in colorspace]</em></p><p>Repeat-aware modeling and correction of short read errors. Yang et al, BMC Bioinformatics 12(Supp1):S52, 2011 <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3044310"> <span style="text-decoration: underline;">PubMedCentral</span></a> <em>[requires a reference sequence]</em></p><p>HiTEC: accurate error correction in high-throughput sequencing data. Ilie et al, Bioinformatics 27(3):295, 2011 <a href="http://bioinformatics.oxfordjournals.org/content/27/3/295.long"><span style="text-decoration: underline;">Full Text</span></a></p><p>Error correction of high-throughput sequencing datasets with non-uniform coverage. Medvedev et al., Bioinformatics 27(13):i137-41, 2011. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3117386"><span style="text-decoration: underline;">PubMedCentral</span></a></p><h3>De novo assembly<span style="text-decoration: underline;"> </span></h3><p>Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Zerbino &amp; Birney, Genome Res 18(5):821-9, 2008. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2336801">u&gt;PubMedCentral</a></p><p>Assembly of large genomes using second-generation sequencing. Schatz et al, Genome Res 20(9):1165-73, 2010. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2928494"><span style="text-decoration: underline;">PubMedCentral</span></a></p><p>High-quality draft assemblies of mammalian genomes from massively parallel sequence data. Gnerre et al, PNAS 108(4): 1513-18, 2011 <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3029755"><span style="text-decoration: underline;">PubMedCentral</span></a></p><p>Genome assembly has a major impact on gene content: a comparison of annotation in two <em>Bos taurus </em> assemblies. Florea&nbsp; et al., PLoS One 6(6):e21400, 2011. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3120881/"><span style="text-decoration: underline;">PubMedCentral</span></a></p><p>Artemis: an integrated platform for visualization and analysis of high-throughput sequence-based experimental data. Carver et al, Bioinformatics 28(4):464 - 469, 2012 <span style="text-decoration: underline;"><a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3278759/">PubMedCentral</a></span></p><p>Efficient de novo assembly of large genomes using compressed data structures. Simpson &amp; Durbin, Genome Research 22:549-556, 2012 <span style="text-decoration: underline;"><a href="http://genome.cshlp.org/content/22/3/549.full">Full Text</a></span> <em>[Describes the String Graph Assembler (SGA), which assembled a human genome in less than 6 days using 54 Gb of RAM and a 123-processor compute cluster for calculation of an FM-index of the 1.2 billion reads]</em></p><p>Readjoiner: a fast and memory efficient string graph-based sequence assembler. Gonnella &amp; Kurtz, BMC Bioinformatics 13: 82, 2012 <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3507659"><span style="text-decoration: underline;">PubMedCentral</span></a></p><p>Assemblathon 1: A competitive assessment of de novo short read assembly methods. Earl et al, Genome Research 21:2224-2241, 2011 <span style="text-decoration: underline;"><a href="http://genome.cshlp.org/content/early/2011/09/16/gr.126599.111.full.pdf+html">Full Text</a></span></p><h3>Chromatin immunoprecipation analysis: ChIP-seq</h3><p>ChIP-seq: advantages and challenges of a maturing technology. Park, Nat Rev Genet. 10:669-80, 2009 <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3191340/"><span style="text-decoration: underline;">PubMed</span></a></p><p>ChIP-seq and Beyond: new and improved methodologies to detect and characterize protein-DNA interactions. Furey, Nat Rev Genet 13: 840&ndash;852, 2012 <a href="http://www.nature.com/nrg/journal/v13/n12/full/nrg3306.html"> <span style="text-decoration: underline;">Publisher Web Site</span></a></p><p>MuMoD: a Bayesian approach to detect multiple modes of protein&ndash;DNA binding from genome-wide ChIP data. Narlikar, Nucleic Acids Res 41:21&ndash;32, 2013 <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3592440/"><span style="text-decoration: underline;">PubMed</span></a></p><h3>Transcriptome analysis</h3><h3>Assembly and comparison to genome</h3><p>Full-length transcriptome assembly from RNA-Seq data without a reference genome. Grabherr et al, Nature Biotechnology 29:644 - 652, 2011. <a href="http://www.ncbi.nlm.nih.gov/pubmed/21572440"><span style="text-decoration: underline;">PubMed</span></a> <em>[The software is called <a href="http://trinityrnaseq.sourceforge.net/"><span style="text-decoration: underline;">Trinity</span></a>, and is available on Sourceforge.]</em></p><p>Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Peng et al, Nature Biotechnology 30:253 - 260, 2012. <span style="text-decoration: underline;"><a href="http://www.ncbi.nlm.nih.gov/pubmed/22327324">PubMed</a></span> <em>[Several comments on this paper question whether the reported differences are in fact evidence of editing or are simply sequencing errors - the authors stand by their conclusions, but the controversy demonstrates the importance of robust data analysis methods.] </em></p><p>Optimization of de novo transcriptome assembly from next-generation sequencing data. Surget-Groba &amp; Montoya-Burgos, Genome Res 20(10):1432-40, 2010. <a href="http://genome.cshlp.org/content/20/10/1432.long"><span style="text-decoration: underline;">Full Text</span></a></p><p>Rnnotator: an automated <em>de novo</em> transcriptome assembly pipeline from stranded RNA-Seq reads. Martin et al, BMC Genomics 11:663, 2010 <a href="http://www.biomedcentral.com/1471-2164/11/663"><span style="text-decoration: underline;">Full Text</span></a></p><p><em>De novo</em> assembly and analysis of RNA-seq data. Robertson et al, Nature Methods 7:909-912, 2010 <a href="http://www.nature.com/nmeth/journal/v7/n11/full/nmeth.1517.html"><span style="text-decoration: underline;">Full Text</span></a> <em>[describes Trans-ABySS, a pipeline to use the ABySS parallel assembler for de novo transcriptome analysis]</em></p><h3>Differential expression analysis</h3><p>R-SAP: a multi-threading computational pipeline for the characterization of high-throughput RNA-sequencing data. Mittal &amp; McDonald, Nucleic Acids Res, 2012 <span style="text-decoration: underline;"><a href="http://nar.oxfordjournals.org/content/early/2012/01/28/nar.gks047.long">Full Text</a></span></p><p>Targeted RNA sequencing reveals the deep complexity of the human transcriptome. Mercer et al, Nature Biotechnology 30:99 - 104, 2012 <span style="text-decoration: underline;"><a href="http://www.nature.com/nbt/journal/v30/n1/full/nbt.2024.html"> Publisher Website</a></span></p><p>Differential gene and transcript expression analysis of RNA-Seq experiments with TopHat and Cufflinks. Trapnell et al, Nature Protocols 7:562 - 578, 2012 <span style="text-decoration: underline;"><a href="http://www.nature.com/nprot/journal/v7/n3/full/nprot.2012.016.html"> Publisher Website</a></span></p><p>Characterization and improvement of RNA-Seq precision in quantitative transcript expression profiling. Łabaj et al, Bioinformatics 27:i383 - i391, 2011 <span style="text-decoration: underline;"><a href="http://bioinformatics.oxfordjournals.org/content/27/13/i383.full.pdf+html"> Full Text</a></span></p><p>Improving RNA-Seq expression estimates by correcting for fragment bias. Roberts et al, Genome Biol 12:R22, 2011 <span style="text-decoration: underline;"><a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3129672/">PubMed Central</a></span></p><p>Cloud-scale RNA-sequencing differential expression analysis with Myrna. Langmead et al, Genome Biol 11:R83, 2010 <a href="http://genomebiology.com/2010/11/8/R83"><span style="text-decoration: underline;">Full Text</span></a></p><p>From RNA-seq reads to differential expression results. Oshlack et al, Genome Biol 11(12):220, 2010 <a href="http://genomebiology.com/content/11/12/220"><span style="text-decoration: underline;">Full Text</span></a></p><p>DEGseq: an R package for identifying differentially expressed genes from RNA-seq data. Wang et al., Bioinformatics. 26(1):136-8. 2010 <a href="http://www.ncbi.nlm.nih.gov/pubmed/19855105"><span style="text-decoration: underline;"> PubMed</span></a></p><p>DEseq: Differential expression analysis for sequence count data. Anders and Huber, Genome Biology 11:R106, 2010 <a href="http://genomebiology.com/2010/11/10/R106"><span style="text-decoration: underline;">Full Text</span></a></p><p>edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Robinson et al., Bioinformatics 26(1):139-40 2010 <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2796818"> <span style="text-decoration: underline;">PubMedCentral</span></a></p><p>Two-stage Poisson model for testing RNA-seq data. Auer and Doerge, SAGMB 10(1), article 26 <a href="http://www.bepress.com/sagmb/vol10/iss1/art26/"><span style="text-decoration: underline;">Full Text</span></a></p><p>Experimental design, preprocessing, normalization and differential expression analysis of small RNA sequencing experiments. McCormick et al., Silence2(1):2, 2011 <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3055805"><span style="text-decoration: underline;">PubMedCentral</span></a></p><p>RNA-Seq gene expression estimation with read mapping uncertainty. Li et al, Bioinformatics 26:493-500, 2010 <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2820677">PubMedCentral</a> <em>[describes the RSEM software package]</em></p><h3>Comparing genomes and assemblies; variant detection<span style="text-decoration: underline;"> </span></h3><p>Versatile and open software for comparing large genomes. Kurtz et al, Genome Biol (5(2):R12, 2004. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC395750"><span style="text-decoration: underline;">PubMedCentral</span></a> <em>[describes the MUMmer software for full-genome alignment &amp; comparisons]</em></p><p>Searching for SNPs with cloud computing. Langmead et al, Genome Biol 10(11):R134, 2009 <a href="http://genomebiology.com/content/10/11/R134"><span style="text-decoration: underline;">Full Text</span></a></p><p>Calling SNPs without a reference sequence. Ratan et al, BMC Bioinformatics 11:130, 2010 <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2851604"><span style="text-decoration: underline;">PubMedCentral</span></a></p><p>Microindel detection in short-read sequence data. Krawitz et al, Bioinformatics 26(6):722-9, 2010. <a href="http://bioinformatics.oxfordjournals.org/content/26/6/722.long"><span style="text-decoration: underline;">Full Text</span></a></p><p>vipR: variant identification in pooled DNA using R. Altmann et al., Bioinformatics 27: i77-i84, 2011. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3117388"><span style="text-decoration: underline;">PubMedCentral</span></a></p><p>Geoseq: a tool for dissecting deep-sequencing datasets. Gurtowski et al, BMC Bioinformatics 11:506, 2010. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2972303/"><span style="text-decoration: underline;">PubMedCentral</span></a> <em>[Geoseq is a web service that allows searching deep sequencing datasets with a reference sequence of a gene of interest]</em></p><p>Detecting and annotating genetic variations using the HugeSeq pipeline. Lam et al, Nature Biotechnology 30:226 - 229, 2012 <span style="text-decoration: underline;"><a href="http://www.nature.com/nbt/journal/v30/n3/full/nbt.2134.html">Publisher Website</a></span>, <span style="text-decoration: underline;"><a href="http://hugeseq.snyderlab.org/">Home Page</a></span></p><p>Genome-wide LORE1 retrotransposon mutagenesis and high-throughput insertion detection in <em>Lotus japonicus</em>. Urbański et al, Plant J 64:731-741, 2012. <span style="text-decoration: underline;"><a href="http://onlinelibrary.wiley.com/doi/10.1111/j.1365-313X.2011.04827.x/abstract">Publisher Website</a></span> <em>[This paper describes a 2-dimensional pooling strategy with barcoding to allow use of Illumina sequencing to screen for retrotransposon insertion mutations, and includes a software package called FSTpoolit for analysis of the resulting sequence reads.]</em></p><h3>Genotyping by sequencing</h3><p>Genome-wide genetic marker discovery and genotyping using next-generation sequencing. Davey et al., Nat Rev Genet 12(7):499-510, 2011 <a href="http://www.ncbi.nlm.nih.gov/pubmed/21681211"><span style="text-decoration: underline;">PubMed</span></a> <em>[A review of methods available at the time]</em></p><p>A robust, simple genotyping-by-sequencing (GBS) approach for high diversity species. Elshire et al., PLoS One 6(5):e19379, 2011. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3087801"><span style="text-decoration: underline;">Full Text</span></a></p><p>Development of high-density genetic maps for barley and wheat using a novel two-enzyme genotyping-by-sequencing approach. Poland et al., PLoS One 7(2): e32253, 2012. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3289635/"><span style="text-decoration: underline;">Full Text</span></a></p><p>Double digest RADseq: an inexpensive method for de novo SNP discovery and genotyping in model and non-model species. Peterson et al, PLoS One 7(5):e37135, . 2012. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3365034/"><span style="text-decoration: underline;">Full Text</span></a></p><p>Imputation of unordered markers and the impact on genomic selection accuracy. Rutkowski et al, G3 3(3):427-39, 2013. <a href="http://www.g3journal.org/content/3/3/427.long"><span style="text-decoration: underline;">Full Text</span></a></p><p>Diversity Arrays Technology (DArT) and next-generation sequencing combined: genome-wide, high-throughput, highly informative genotyping for molecular breeding of <em>Eucalyptus</em>. Sansaloni et al., BMC Proceedings 5(Suppl 7):P54, 2011 <span style="text-decoration: underline;"><a href="http://www.biomedcentral.com/1753-6561/5/S7/P54">Full Text</a></span></p><p>High-throughput genotyping by whole-genome resequencing. Huang et al., Genome Res 19(6):1068-76, 2009. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2694477"><span style="text-decoration: underline;">Full Text</span></a></p><p>Multiplexed shotgun genotyping for rapid and efficient genetic mapping. Andolfatto et al. Genome Res 21(4):610-7, 2011. <a href="http://genome.cshlp.org/content/21/4/610.long"><span style="text-decoration: underline;">Full Text</span></a></p><h3>Restriction-site Associated DNA (RAD) markers</h3><p>Rapid SNP discovery and genetic mapping using sequenced RAD markers. Baird et al, PLoS One 3(10):e3376, 2008 <span style="text-decoration: underline;"><a href="http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0003376">Full Text</a></span></p><p>Linkage mapping and comparative genomics using next-generation RAD sequencing of a non-model organism. Baxter et al., PLoS One 6(4):e19315, 2011. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3082572"><span style="text-decoration: underline;">Full Text</span></a></p><p>Genome evolution and meiotic maps by massively parallel DNA sequencing: spotted gar, an outgroup for the teleost genome duplication. Amores et al, Genetics 188(4):799-808, 2011. <a href="http://www.ncbi.nlm.nih.gov/pubmed/21828280"><span style="text-decoration: underline;"> PubMed</span></a></p><p>Construction and application for QTL analysis of a Restriction-site Associated DNA (RAD) linkage map in barley. Chutimanitsakun et al, BMC Genomics 4; 12:4, 2011. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3023751"><span style="text-decoration: underline;">Full Text</span></a></p><p>RAD tag sequencing as a source of SNP markers in <em>Cynara cardunculus </em>L. Scaglione et al., BMC Genomics 13:3, 2012. <span style="text-decoration: underline;"><a href="http://www.biomedcentral.com/1471-2164/13/3">Full Text</a></span></p><p>Paired-end RAD-seq for de novo assembly and marker design without available reference. Willing et al., Bioinformatics 27(16):2187-93, 2011. <a href="http://bioinformatics.oxfordjournals.org/content/27/16/2187.long"><span style="text-decoration: underline;">Publisher Website</span></a></p><p>Local de novo assembly of RAD paired-end contigs using short sequencing reads. Etter et al., PLOS ONE 6(4): e18561, 2011. <a href="http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0018561"><span style="text-decoration: underline;">Full Text</span></a></p><p>Stacks: building and genotyping loci de novo from short-read sequences. Catchen et al., G3: Genes, Genomes, Genetics, 1:171-182, 2011. <span style="text-decoration: underline;"> Full Text</span>, <a href="http://creskolab.uoregon.edu/stacks/"><span style="text-decoration: underline;">Home Page</span></a></p><p>Rainbow: an integrated tool for efficient clustering and assembling RAD-seq reads. Chong et al, Bioinformatics 28(21):2732-7, 2012. <a href="http://bioinformatics.oxfordjournals.org/content/28/21/2732.long"> <span style="text-decoration: underline;">Publisher Website</span></a></p><p>UK RAD Sequencing Wiki page, with bibliography and RADTools software download <a href="https://www.wiki.ed.ac.uk/display/RADSequencing/Home"><span style="text-decoration: underline;">Home Page</span></a></p><h3>Workspace environments</h3><p><span style="text-decoration: underline;">Papers</span></p><p>Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences. Goecks et al, Genome Biol 11(8):R86, 2010 <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2945788"><span style="text-decoration: underline;">PubMedCentral</span></a></p><p>Galaxy Cloudman: Delivering compute clusters. BMC Bioinformatics 11(Suppl. 12):S4, 2010 <a href="http://www.biomedcentral.com/content/pdf/1471-2105-11-S12-S4.pdf"><span style="text-decoration: underline;">Full Text</span></a></p><p><a href="http://www.broadinstitute.org/gsa/wiki/index.php/The_Genome_Analysis_Toolkit"><span style="text-decoration: underline;">The Genome Analysis Toolkit</span></a>: a MapReduce framework for analyzing next-generation DNA sequencing data. McKenna et al, Genome Res 20(9):1297-303, 2010. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2928508"><span style="text-decoration: underline;">PubMedCentral</span></a></p><p>A framework for variation discovery and genotyping using next-generation DNA sequencing data. DePristo et al., Nat Genet 43(5):491-8, 2011. <a href="http://www.ncbi.nlm.nih.gov/pubmed/21478889"><span style="text-decoration: underline;"> PubMed</span></a></p><p><span style="text-decoration: underline;">Online resources</span></p><p>The <a href="http://cran.r-project.org/"><span style="text-decoration: underline;">R statistical computing</span></a> environment includes<a href="http://www.bioconductor.org/"><span style="text-decoration: underline;"> Bioconductor</span></a>, a specialized set of tools for analysis of microarray and high-throughput sequencing data. Introductory materials from on-line or short workshops are widely available online; examples are <span style="text-decoration: underline;"><a href="http://bioconductor.org/help/course-materials/2012/Evomics2012/Bioconductor-tutorial.pdf">Evomics2012 Bioconductor-tutorial.pdf</a></span>, and <a href="http://bcb.dfci.harvard.edu/%7Eaedin/courses/Bioconductor/"><span style="text-decoration: underline;">Intro to Bioconductor</span></a>. Materials from an advanced course on high-throughput genetic data analysis are at <span style="text-decoration: underline;"><a href="http://bioconductor.org/help/course-materials/2012/SeattleFeb2012/">Seattle 2012 materials</a></span>. Thomas Girke of UC-Riverside has written a very complete set of manuals describing the use of R and Bioconductor for analysis of genomic datasets, available at <a href="http://manuals.bioinformatics.ucr.edu/home/R_BioCondManual">R and Bioconductor Manuals</a>. <br /> <a href="http://cran.r-project.org/manuals.html"><span style="text-decoration: underline;">Manuals</span></a> and contributed <a href="http://cran.r-project.org/other-docs.html"><span style="text-decoration: underline;">documentation</span></a> for R are available at the R-project.org website, and video tutorials are also available on Youtube; those posted by Tutorlol are brief, clear, and to the point. <br /> Materials from a series of mini-courses in R taught in 2010 at UCLA are available:</p><ul>
<li><a href="http://scc.stat.ucla.edu/page_attachments/0000/0141/10S-basicR.pdf">Intro to programming and graphics</a></li>
<li><a href="http://scc.stat.ucla.edu/page_attachments/0000/0143/S10_RProgII.pdf">Data manipulation and functions</a></li>
<li><a href="http://scc.stat.ucla.edu/page_attachments/0000/0185/Graphics_course.pdf">Graphics for exploratory data analysis</a></li>
<li><a href="http://scc.stat.ucla.edu/page_attachments/0000/0147/20100503_IntroStats.pdf">Introductory statistics</a></li>
<li><a href="http://scc.stat.ucla.edu/page_attachments/0000/0188/reg_R_1_09S_slides.pdf">Linear regression</a></li>
</ul><p><a href="http://a-little-book-of-r-for-bioinformatics.readthedocs.org/en/latest/"> <span style="text-decoration: underline;">A Little Book of R for Bioinformatics</span></a> is an on-line resource with information and exercises to provide practice in bioinformatics analysis of DNA sequences and other biological data in R. <br /> Many books on specific topics in R programming are also available through Amazon or other vendors.</p><h3>Cloud computing resources</h3><p>The case for cloud computing in genome informatics. Lincoln Stein, Genome Biol. 11(5):207, 2010 <a href="http://www.ncbi.nlm.nih.gov/pubmed/20441614"><span style="text-decoration: underline;">Pubmed</span></a></p><p>Galaxy Cloudman: delivering cloud compute clusters. Afgan et al, BMC Bioinformatics <span style="text-decoration: underline;">11</span>(Suppl 12):S4, 2010 <a href="http://www.biomedcentral.com/1471-2105/11/S12/S4"><span style="text-decoration: underline;">Full Text</span></a></p><p><a href="http://cloudbiolinux.com/">CloudBioLinux</a> is an open-source project that provides a bioinformatics Linux system for cloud computing, pre-configured with a variety of software tools installed and ready to use.</p><p>A <a href="https://github.com/chapmanb/cloudbiolinux/blob/master/doc/intro/gettingStarted_CloudBioLinux.pdf?raw=true"><span style="text-decoration: underline;">tutorial</span></a> on getting started with CloudBioLinux on the Amazon Web Services Elastic Compute Cloud (EC2)</p><p><a href="http://userwww.service.emory.edu/%7Eeafgan/content/ppt/EnisAfgan_BOSC_2010.pdf"><span style="text-decoration: underline;">Deploying Galaxy on the Cloud</span></a>  slides from a presentation by Enis Afgan (Emory University) at the <br /> &nbsp;Bioinformatics Open Source Conference in Boston, July 2010</p><p>A <a href="http://screencast.g2.bx.psu.edu/cloud/"><span style="text-decoration: underline;"> screencast</span></a> that provides a step-by-step guide to starting a Galaxy cluster in the EC2 environment</p><p>A <a href="https://bitbucket.org/galaxy/galaxy-central/wiki/cloud"><span style="text-decoration: underline;">webpage</span></a> that has the same information in text form, and is the basis for the screencast</p><p>The iPlant Collaborative, an NSF-funded project to create computational resources for plant biology research, provides access to cloud computing resources through <span style="text-decoration: underline;"><a href="http://www.iplantcollaborative.org/discover/atmosphere">Atmosphere</a></span></p><p>SeqWare Query Engine: storing and searching sequence data in the cloud. OConnor et al, BMC Bioinformatics <strong>11</strong>(Suppl 12)<strong>:</strong>S2, 2010 <a href="http://www.biomedcentral.com/1471-2105/11/S12/S2"><span style="text-decoration: underline;">Full Text</span></a></p><p>An overview of the Hadoop/MapReduce/HBase framework and its current applications in bioinformatics. Taylor, BMC Bioinformatics <strong>11</strong>(Suppl 12)<strong>:</strong>S1, 2010 <a href="http://www.biomedcentral.com/1471-2105/11/S12/S1"><span style="text-decoration: underline;">Full Text</span></a></p><h3>Links to Linux command-line tutorials and resources</h3><p>Tutorials for AWK, a powerful tool for handling data tables</p><ul>
<li>A set of <a href="http://people.bu.edu/scottm/AWK.NOTES"><span style="text-decoration: underline;">awk notes</span></a> from Boston University</li>
<li>Bruce Barnett's <a href="http://www.grymoire.com/Unix/Awk.html"><span style="text-decoration: underline;">awk tutorial</span></a></li>
<li>Greg Goebel's <a href="http://www.vectorsite.net/tsawk.html"><span style="text-decoration: underline;">awk tutorial</span></a></li>
<li><a href="http://teaching.software-carpentry.org/2013/01/16/1433/"><span style="text-decoration: underline;">Executing an awk command from R</span></a> to simplify data exploratory analysis, from Lex Nederbragt</li>
</ul><p>Tutorials for bash shell scripting</p><ul>
<li>A <a href="http://www.linuxconfig.org/bash-scripting-tutorial"><span style="text-decoration: underline;">tutorial</span></a> at linuxconfig.org</li>
<li>A <a href="http://www.hypexr.org/bash_tutorial.php"><span style="text-decoration: underline;">Getting Started With Bash</span></a> tutorial at hypexr.org</li>
<li>Mendel Cooper's <a href="http://tldp.org/LDP/abs/html/"><span style="text-decoration: underline;">Advanced Bash Shell-Scripting Guide</span></a></li>
</ul><p>Tutorials for sed, the command-line stream editor</p><ul>
<li>A <a href="http://www.panix.com/%7Eelflord/unix/sed.html"><span style="text-decoration: underline;">tutorial</span></a> at Rutgers</li>
<li>Peteris Krumins claims to have the <a href="http://www.catonmat.net/blog/worlds-best-introduction-to-sed/"><span style="text-decoration: underline;"> World's Best Introduction to Sed</span></a>; take a look and judge for yourself.</li>
<li>Bruce Barnett's <a href="http://www.grymoire.com/Unix/Sed.html"><span style="text-decoration: underline;">sed tutorial</span></a>.</li>
</ul><h3>Links to other useful sites</h3><p>The<a href="http://seqanswers.com/"><span style="text-decoration: underline;"> SEQanswers</span></a> online community has forums on several topics related to sequencing; the bioinformatics forum is the most active.</p><p>The SEQanswers <span style="text-decoration: underline;"><a href="http://seqanswers.com/wiki/Software">Software Wiki</a></span> is a list of software for analysis of sequencing data</p><p><a href="http://biostar.stackexchange.com/">Biostar</a> is another online community for questions and answers on bioinformatics and computational genomics.</p><p>Information on file formats used by the University of California - Santa Cruz Genome Browser is on the <a href="http://genome.ucsc.edu/FAQ/FAQformat"><span style="text-decoration: underline;"> FAQ list</span></a></p><p>A manual for the Integrated Genome Browser visualization tool is <a href="http://wiki.transvar.org/confluence/display/igbman/Home"><span style="text-decoration: underline;">here</span></a></p><p>Course materials for a short course entitled <a href="http://bioconductor.org/help/course-materials/2010/SeattleIntro/"><span style="text-decoration: underline;">Introduction to R and Bioconductor</span></a>, held in Seattle in Dec 2010</p><p><a href="http://great.stanford.edu/"><span style="text-decoration: underline;">Genomic Regions Enrichment of Annotations Tool</span></a> - A web service to test for over-representation of specific ontology categories among genes near ChIP-seq peaks</p><p><a href="http://www.animalgenome.org/bioinfo/resources/nextgensoft.html"><span style="text-decoration: underline;">Next-gen-seq software</span></a> - a list of software packages, both commercial and open-source, related to analysis of deep sequencing datasets</p><p><a href="http://www.cbcb.umd.edu/software/"><span style="text-decoration: underline;">Software</span></a> from the Center for Bioinformatics and Computational Biology, University of Maryland - many useful programs, all open-source</p><p><a href="http://bioinformatics.psb.ugent.be/plaza/"><span style="text-decoration: underline;"> PLAZA</span></a>: a comparative genomics resource to study gene and genome evolution in plants; described by Proost et al, Plant Cell 21:3718, 2010 <a href="http://www.plantcell.org/content/21/12/3718.full"><span style="text-decoration: underline;">Full Text</span></a></p><p>The European Bioinformatics Institute provides tools <a href="http://www.ebi.ac.uk/Tools/rcloud/"><span style="text-decoration: underline;">ArrayExpressHTS</span><span style="text-decoration: underline;"> and R-Cloud</span></a> for analysis of transcriptome data</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/7088/gabi</guid>
  <pubDate>Fri, 06 Dec 2013 16:43:01 -0600</pubDate>
  <link></link>
  <title><![CDATA[GABi]]></title>
  <description><![CDATA[
<p>GABi Research<br />The major researching fields defined as the GABi scope are described next:<br />    Sequence Analysis<br />    Protein Structure Prediction<br />    Comparative Genomics<br />    Functional Analysis of Residues on Protein Families<br />    Gene/Protein Networks<br />    Genome structure &amp; base composition<br />    Highthroughput data analysis from NGS</p>

<p>Lab Page http://gabi.cidbio.org/index/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/10741/managing-and-analyzing-next-generation-sequence-data</guid>
	<pubDate>Sat, 10 May 2014 06:28:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/10741/managing-and-analyzing-next-generation-sequence-data</link>
	<title><![CDATA[Managing and Analyzing Next-Generation Sequence Data]]></title>
	<description><![CDATA[<p>Centralized Bioinformatics Core Facilities provide shared resources for the computational and IT requirements of the investigators in their department or institution. As such, they must be able to effectively react to new types of experimental technology. Recently faced with an unprecedented flood of data generated by the next generation of DNA sequencers, these groups found it necessary to respond quickly and efficiently to the informatics and infrastructure demands. Centralized Facilities newly facing this challenge need to anticipate time and design considerations of necessary components, including infrastructure upgrades, staffing, and tools for data analyses and management ...</p>
<p>More at http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1000369</p><p>Address of the bookmark: <a href="http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1000369" rel="nofollow">http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1000369</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/11355/genomics-and-personalized-medicine-breakthroughs</guid>
	<pubDate>Sun, 01 Jun 2014 23:40:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/11355/genomics-and-personalized-medicine-breakthroughs</link>
	<title><![CDATA[Genomics and Personalized Medicine Breakthroughs]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/VAR-1vNc0TE" frameborder="0" allowfullscreen></iframe>http://bit.ly/e8QGzY Human genome mapping is now enabling a breakthrough in medical innovation -- personalized medicine. What does this mean for patients? We can now identify predispositions to disease, predict how we metabolize drugs, and figure out what kinds of treatments we may respond to, and even determine when a drug may give us an adverse reaction. All medical specialties benefit from human genome intelligence -- oncology saw the first impacts -- but advances are now being seen in cardiology, obstetrics and gynecology, pediatric diseases, gastroenterology, rheumatology, immunology and other areas. This video covers the areas that genetic medicine is impacting and where the future of genomic medicine is heading.]]></description>
	
</item>

</channel>
</rss>