<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/4094?offset=260</link>
	<atom:link href="https://bioinformaticsonline.com/related/4094?offset=260" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/22053/binc-sample-question-paper</guid>
	<pubDate>Thu, 16 Apr 2015 09:16:18 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/22053/binc-sample-question-paper</link>
	<title><![CDATA[BINC Sample Question Paper !!!]]></title>
	<description><![CDATA[<p>BINC sample question paper. Wish you all the best for BINC examination.</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/22053" length="4041" type="text/plain" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/22769/ensembl-27</guid>
	<pubDate>Tue, 16 Jun 2015 16:10:36 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/22769/ensembl-27</link>
	<title><![CDATA[Ensembl 27]]></title>
	<description><![CDATA[<h3>What is new?</h3><ul>
<li>Expansion of Protists and Fungi with hundreds of annotated genomes</li>
<li>Variation data for bread wheat, rice, <em>Aedes aegypti</em>, and <em>Ixodes scapularis</em></li>
<li>Whole genome alignments for <em>O. longistaminata</em> and <em>T. cacao</em></li>
<li>Non-coding RNA gene models in <a href="http://bacteria.ensembl.org">Bacteria</a></li>
<li>New assembly of tomato (version 2.50)</li>
<li>Full support for UCSC Track Hub format for hosting your own data in Ensembl</li>
</ul><p>More at http://www.ensembl.info/blog/2015/06/16/ensembl-genomes-release-27-is-out/</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/22920/how-long-have-you-been-a-bioinformatics-scientist-for</guid>
	<pubDate>Tue, 23 Jun 2015 10:55:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/22920/how-long-have-you-been-a-bioinformatics-scientist-for</link>
	<title><![CDATA[How long have you been a bioinformatics scientist for?]]></title>
	<description><![CDATA[<p>Most of the researcher have been a scientist whole life, but infact they actually started paying&nbsp; it with at certain time.So, how long have you been in bioinformatics domain now?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/23160/opencpu</guid>
	<pubDate>Sun, 05 Jul 2015 18:34:46 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/23160/opencpu</link>
	<title><![CDATA[OpenCPU]]></title>
	<description><![CDATA[<p>OpenCPU is a system for embedded scientific computing and reproducible research. The OpenCPU server provides a reliable and interoperable <a href="https://www.opencpu.org/api.html">HTTP API</a> for data analysis based on R.</p><p>The OpenCPU <a href="https://www.opencpu.org/jslib.html">JavaScript client library</a> provides the most seamless integration of R and JavaScript available today.</p><p>OpenCPU uses standard R packaging to develop, ship and deploy web applications. Several open source <a href="https://www.opencpu.org/apps.html">example apps</a> are available from Github.</p><p>Installing your own OpenCPU server is <a href="https://www.opencpu.org/download.html">super easy</a> and only takes a few minutes.</p><p>More at https://www.opencpu.org/</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/23680/five-key-traits-to-seek-out-in-potential-bioinformatics-candidates</guid>
	<pubDate>Mon, 10 Aug 2015 12:53:50 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/23680/five-key-traits-to-seek-out-in-potential-bioinformatics-candidates</link>
	<title><![CDATA[Five key traits to seek out in potential bioinformatics candidates !!!]]></title>
	<description><![CDATA[<p>Genomics and proteomics data are being collected in bulk, but mostly, traditional biologist don&rsquo;t know what to do with it. Perhaps this is the reason why (not only this!!! ) computational biologist/bioinformatics scientists are hot commodities in the research world.</p><p>In fact, there are huge demands for expert biological data analyst. It&rsquo;s a fairly new &nbsp;(not exactly) hot area, these bioinformatician are invaluable because they know and understand the significance of biological data for your research and how you can use it for better understanding of biological problems.</p><p>The bioinformatics can discover biological patterns and stories in genomic and proteomics data. They can develop the pipeline needed to properly collect, store and analyse it.</p><p><img src="http://bioinformaticsonline.com/mod/photo/hire.gif" alt="image" style="border: 0px;"></p><p>Once your research group is ready to make a larger investment and hire a bioinformatician to gain a competitive edge, there are several key traits to seek out in potential candidates. The best bioinformatician are:</p><p>1. Highly Skilled - programming skills, experience with the biological software and tools.</p><p>The biological data won&rsquo;t illuminate much if the scientist analysing it doesn&rsquo;t possess practical programming skills, experience with the biological software and tools and a thorough understanding of basic biological stuff. A solid background in mathematics and statistics is also an indispensable trait.</p><p>2. Insight - Real vision, robust understanding and deep insight.</p><p>In order to hire the best bioinformatics and computational biologist scientist for your needs, it is always recommended and mostly practiced by the recruiters, to ask each contender to write and develop a sample script/presentation based on a specific set of data you provide. Then, explore the approaches used to deal with data provided and pick up those candidates who convey real vision, robust understanding and deep insight.</p><p>3. Energetic &ndash; Curiosity to explore</p><p>Mostly natural curiosity and enthusiasm for solving big biological problems coupled with an ability to transform data into a scientific stories may place one candidate above the rest. In addition to achieve that, the bioinformatician should be agile enough to quickly modify their methods to suit changes within a particular research.</p><p>4. Researcher &ndash; Publications</p><p>Look for someone who has a keen sense and understanding of concern biological problems. You can judge it by looking at previously published papers and data. It is always recommended to have a look at GitHub and other repository for codes written by her/him.</p><p>5. Impressive communicator - Insight that can&rsquo;t be expressed is worthless.</p><p>Good bioinformatics scientists are able to uncover biological patterns and are willing to explain those patterns in clear and helpful ways through thoughtful and open communication. In other words, they should must have good scientific writing skills. A computational biologis/bioinformatician&nbsp; should know how to present the data and tell a scientific story through numbers/images.</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/24264/cancer-research-database</guid>
	<pubDate>Tue, 01 Sep 2015 17:36:31 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/24264/cancer-research-database</link>
	<title><![CDATA[Cancer research database]]></title>
	<description><![CDATA[<p>Researchers in Andhra Pradesh have developed a database to identify genes that are common in tumours to provide their colleagues with easy access to insights into the genetic alterations in cancer.<br /> &nbsp;<br /> The database, hosted at the Sri Venkateswara University (SVU) in Tirupati, will integrate information on cancer genes and markers with experimental data.<br /> &nbsp;<br /> The <a href="http://cgmd.in/" target="_blank">Cancer Gene Markers Database</a> (CGMD) is meant to help scientists better understand tumour genes and markers at a molecular level by combining data with literature on treatment regimen and recent advances in cancer therapy.<br /> <br /> The database is free to access, and already includes 309 genes and 206 markers that correspond to 40 different human cancers. Accompanying literature comes from databases such as the United States&rsquo; <a href="http://www.ncbi.nlm.nih.gov/" target="_blank">National Center for Biotechnology Information</a> and the <a href="http://www.genome.jp/kegg/" target="_blank">Kyoto Encyclopedia of Genes and Genomes</a>. It also includes experimental data from <a href="http://www.ncbi.nlm.nih.gov/pubmed" target="_blank">PubMed</a>.<br /> <br /> In a paper <a href="http://dx.doi.org/10.1038/srep12035" target="_blank">published</a> last month in <em>Nature Scientific Reports</em>, the researchers from SVU&rsquo;s department of animal biotechnology, describes the need for a database for different genes and markers along with their molecular characteristics and pathway associations.</p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26303/maker</guid>
	<pubDate>Sun, 07 Feb 2016 15:59:24 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26303/maker</link>
	<title><![CDATA[MAKER]]></title>
	<description><![CDATA[<p>MAKER is a portable and easily configurable genome annotation pipeline.Its purpose is to allow smaller eukaryotic and prokaryotic genome projects to independently annotate their genomes and to create genome databases. MAKER identifies repeats, aligns ESTs and proteins to a genome, produces ab-initio gene predictions and automatically synthesizes these data into gene annotations having evidence-based quality values.</p>
<p>More at http://www.yandell-lab.org/software/maker.html</p><p>Address of the bookmark: <a href="http://www.yandell-lab.org/software/maker.html" rel="nofollow">http://www.yandell-lab.org/software/maker.html</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26322/liftover</guid>
	<pubDate>Mon, 08 Feb 2016 15:45:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26322/liftover</link>
	<title><![CDATA[liftover]]></title>
	<description><![CDATA[<p><span>Convenient conversions between genome assemblie.&nbsp;The liftover package makes it easy to remap genomic coordinates to a different genome assembly. </span></p>
<p><span>More at https://github.com/aaronwolen/liftover<br></span></p>
<p><span>https://www.bioconductor.org/help/workflows/liftOver/</span></p><p>Address of the bookmark: <a href="https://github.com/aaronwolen/liftover" rel="nofollow">https://github.com/aaronwolen/liftover</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>

</channel>
</rss>