BOL: Related items

Magic Wormhole: The Easiest Way to Send Files Securely

LEGE — Wed, 28 May 2025 06:37:17 -0500

In a world increasingly dependent on digital data exchange, secure and user-friendly file transfer solutions are more important than ever. Enter Magic Wormhole, a deceptively simple yet powerful tool that makes it trivial to send files and messages between computers—securely and without configuration. Whether you're transferring a PDF to a colleague or sending code snippets between your devices, Magic Wormhole has you covered.

What is Magic Wormhole?
Magic Wormhole is an open-source command-line tool that allows you to securely send files or text from one computer to another. Developed by Brian Warner, it aims to eliminate the usual hassle of file transfers: setting up SSH servers, dealing with firewall rules, cloud storage uploads, or even worrying about man-in-the-middle attacks.

Using a combination of PAKE (Password-Authenticated Key Exchange) protocols and end-to-end encryption, Magic Wormhole ensures that the only parties who can see your data are you and your recipient.

“It uses PAKE to establish a secure channel between two computers that use the same one-time code.”

How Does It Work?

One user runs a command like wormhole send file.txt.

The tool generates a human-readable, one-time code (like 7-horse-staple).

The other user types wormhole receive and enters the code.

The file is encrypted, transferred directly (or relayed if needed), and decrypted only on the recipient's side.

All of this happens over a secure channel, with no manual key exchange, configuration, or trust in a central authority.

Example Usage
# Sender
wormhole send myfile.pdf
Sending 1.4 MB file named 'myfile.pdf'
Wormhole code is: 7-horse-staple
# Receiver
wormhole receive
Please enter code: 7-horse-staple
Receiving file (1.4 MB) into: myfile.pdf

That’s it! No email attachments, no cloud storage, no FTP setups.

Why Use Magic Wormhole?
End-to-end encrypted transfers using modern cryptography.

Easy to use even for non-technical users.

Cross-platform: Works on Linux, macOS, and Windows.

No servers needed (except for a lightweight transit relay).

Works even behind NAT/firewalls.

It’s particularly ideal for:

Quickly sharing secrets or passwords.

Distributing software packages securely.

Moving files between servers or VMs.

Under the Hood
Magic Wormhole is written in Python and uses:

SPAKE2 for key exchange.

Transit relay and Mailbox server for message delivery.

Twisted framework for asynchronous networking.

The communication process is decentralized and designed to minimize the trust placed in the relay infrastructure. Even if an attacker intercepts the transit server, they cannot decrypt your data.

Installation

You can install it easily with pip:

pip install magic-wormhole

There’s also a Homebrew package for macOS users:

brew install magic-wormhole
Community and Ecosystem
Magic Wormhole is more than just a file transfer tool. It's part of a growing ecosystem that values user-centric cryptography. There are community-maintained libraries for other languages (e.g., Go, Rust), GUI frontends like wormhole-gui, and integration projects for mobile and web use.

Limitations

While Magic Wormhole is elegant and secure, it’s primarily a command-line utility and not designed for high-volume or persistent file sharing. Transfers require both sender and receiver to be online at the same time. And since it’s peer-to-peer, very large files may suffer performance issues.

Conclusion
Magic Wormhole is a breath of fresh air in the complex world of secure communication. It proves that cryptographic security doesn’t need to come with a heavy user experience cost. If you’re looking for a simple, secure, and delightful way to send files or messages, give Magic Wormhole a try.

Explore the documentation: https://magic-wormhole.readthedocs.io

Pandoc: a universal document converter

Surabhi Chaudhary — Thu, 24 Jun 2021 01:33:47 -0500

If you need to convert files from one markup format into another, pandoc is your swiss-army knife. Pandoc can convert almost all formats

https://pandoc.org/index.html

Address of the bookmark: https://pandoc.org/

Far Manager Commands and Links !

Jit — Tue, 23 Jun 2020 06:24:36 -0500

Far Manager is a program for managing files and archives in Windows operating systems. Far Manager works in text mode and provides a simple and intuitive interface for performing most of the necessary actions:

viewing files and directories;
editing, copying and renaming files;
and many other actions.

https://www.farmanager.com/

Basic instruction at

https://conemu.github.io/en/FarManager.html

Plugins at

https://plugring.farmanager.com/

Address of the bookmark: https://www.farmanager.com/

Opera: An optimal genome scaffolding program

Jit — Mon, 27 Nov 2017 10:18:20 -0600

Opera (Optimal Paired-End Read Assembler) is a sequence assembly program (http://en.wikipedia.org/wiki/Sequence_assembly ). It uses information from paired-end or long reads to optimally order and orient contigs assembled from shotgun-sequencing reads.

An updated version called OPERA-LG has been re-engineered with features for the assembly of large and complex genomes.

Song Gao, Denis Bertrand, Burton K. H. Chia and Niranjan Nagarajan. OPERA-LG: efficient and exact scaffolding of large, repeat-rich eukaryotic genomes with performance guarantees. Genome Biology, May 2016, doi: 10.1186/s13059-016-0951-y.

Song Gao, Wing-Kin Sung, Niranjan Nagarajan. Opera: reconstructing optimal genomic scaffolds with high-throughput paired-end sequences. Journal of Computational Biology, Sept. 2011, doi:10.1089/cmb.2011.0170.

https://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-0951-y

Address of the bookmark: https://sourceforge.net/projects/operasf/

Scripts for the analysis of HGT in genome sequence data.

Jit — Wed, 29 Nov 2017 16:44:10 -0600

Scripts for the analysis of HGT in genome sequence data

Address of the bookmark: https://github.com/reubwn/hgt

Mugsy: multiple whole genome alignment tool

Jit — Fri, 08 Dec 2017 17:41:14 -0600

Mugsy is a multiple whole genome aligner. Mugsy uses Nucmer for pairwise alignment, a custom graph based segmentation procedure for identifying collinear regions, and the segment-based progressive multiple alignment strategy from Seqan::TCoffee. Mugsy accepts draft genomes in the form of multi-FASTA files and does not require a reference genome.

To cite Mugsy, use:

Angiuoli SV and Salzberg SL. Mugsy: Fast multiple alignment of closely related whole genomes.Bioinformatics 2011 27(3):334-4

Address of the bookmark: http://mugsy.sourceforge.net/

GIGGLE: a search engine for large-scale integrated genome analysis

Jit — Wed, 10 Jan 2018 03:10:45 -0600

GIGGLE is a genomics search engine that identifies and ranks the significance of genomic loci shared between query features and thousands of genome interval files. GIGGLE (https://github.com/ryanlayer/giggle) scales to billions of intervals and is over three orders of magnitude faster than existing methods. Its speed extends the accessibility and utility of resources such as ENCODE, Roadmap Epigenomics, and GTEx by facilitating data integration and hypothesis generation.

https://www.nature.com/articles/nmeth.4556

Address of the bookmark: https://github.com/ryanlayer/giggle

MUMmer4: A fast and versatile genome alignment system

Jit — Sat, 03 Feb 2018 04:59:17 -0600

MUMmer4, a substantially improved version of MUMmer that addresses genome size constraints by changing the 32-bit suffix tree data structure at the core of MUMmer to a 48-bit suffix array, and that offers improved speed through parallel processing of input query sequences. With a theoretical limit on the input size of 141Tbp, MUMmer4 can now work with input sequences of any biologically realistic length. We show that as a result of these enhancements, the nucmer program in MUMmer4 is easily able to handle alignments of large genomes;

Address of the bookmark: https://mummer4.github.io/

G-compass: a comparative genome browser

Jit — Thu, 12 Apr 2018 10:00:27 -0500

G-compass (http://www.h-invitational.jp/g-compass/) is a comparative genome browser. It visualizes evolutionarily conserved genomic regions between human and other 12 vertebrates based on original genome alignments pursuing higher coverage (1,2). Annotations of human genes/transcripts and their ortholog information were derived from H-InvDB and its subdatabase Evola, respectively. G-compass is available for free of charge. [ Sample ]

Address of the bookmark: http://www.h-invitational.jp/g-compass/

LINKS scaffolder bloomfilter setting !

Jit — Fri, 15 Jun 2018 10:39:54 -0500

➜ bin git:(master) ✗ ls -l
total 68
drwxrwxr-x 3 urbe urbe 4096 Jun 15 12:15 lib
-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS
➜ bin git:(master) ✗ pwd
/home/urbe/Tools/LINKS_1.8.6/bin

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr