version 1.0.0 - updates several descriptions and tests. To achieve v0.9.4, one can visit https://github.com/zhyqin/SEASTAR-0.9.4 for download.

Address of the bookmark: https://github.com/Xinglab/SEASTAR

Key Components

1. Sample Collection: Meta-transcriptomics begins with the collection of environmental samples. These samples are often complex, containing a wide range of microorganisms.

2. RNA Extraction: RNA is extracted from the sample, which includes mRNA, rRNA, tRNA, and other non-coding RNAs. This step is crucial as it determines the quality and representativeness of the data.

3. Sequencing: High-throughput RNA sequencing (RNA-seq) technologies are used to obtain sequences of the RNA transcripts. This step provides a vast amount of data on the RNA molecules present in the sample.

4. Data Analysis: Computational tools and bioinformatics methods are employed to process and analyze the sequencing data. This involves mapping RNA sequences to reference genomes or transcriptomes, identifying expressed genes, and quantifying their abundance.

5. Functional Annotation: The functional roles of identified transcripts are inferred based on known gene functions, allowing researchers to understand the metabolic and ecological functions of the microbial community.

Applications

1. Environmental Monitoring: Meta-transcriptomics can be used to monitor the health and functional status of ecosystems. For example, it can help assess the impact of pollution on microbial communities by revealing changes in gene expression related to stress response and degradation processes.

2. Microbiome Research: In human health, meta-transcriptomics offers insights into the gut microbiome’s functional state. It helps in understanding how microbial communities interact with their host, how they respond to dietary changes, and their role in health and disease.

3. Biotechnology: The technique can aid in the discovery of novel enzymes and bioactive compounds by profiling microbial communities in extreme environments or industrial processes.

4. Disease Pathogenesis: By analyzing RNA profiles from disease-associated environments, researchers can uncover pathogen-host interactions and identify potential targets for therapeutic interventions.

Challenges

1. Complexity of Data: The sheer volume and complexity of data generated by meta-transcriptomics can be overwhelming. Effective data management and advanced computational tools are required to extract meaningful insights.

2. Sampling Bias: Environmental samples can be heterogeneous, and RNA extraction methods may introduce biases, potentially affecting the accuracy of the results.

3. Reference Databases: Incomplete or biased reference databases can hinder the accurate functional annotation of transcripts, especially when studying novel or poorly characterized organisms.

Future Directions

Meta-transcriptomics is a rapidly evolving field, with ongoing advancements in sequencing technologies and bioinformatics. Future research may focus on improving data integration, developing more comprehensive reference databases, and enhancing our understanding of microbial community dynamics in various environments. As these challenges are addressed, meta-transcriptomics will continue to provide valuable insights into the functional roles of microorganisms and their interactions within ecosystems.

Conclusion

Meta-transcriptomics represents a powerful tool for exploring the functional aspects of microbial communities in their natural environments. By capturing a snapshot of gene expression and metabolic activities, this approach offers a deeper understanding of ecological interactions, health implications, and biotechnological potentials. As technology and methodologies advance, meta-transcriptomics is poised to make significant contributions to our knowledge of the microbial world.

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

Is this available, or still under trial mode? 

https://www.nanoporetech.com/

https://www.nanoporetech.com/technology/the-minion-device-a-miniaturised-sensing-system/the-minion-device-a-miniaturised-sensing-system

H. contortus is a member of the superfamily trichostrongyloidea (Strongylida) which contains most of the economically important parasitic nematodes of grazing livestock. These parasites cost the global livestock industry billions of dollars per annum in lost production and drug costs. A common type of clover may be a preventative or palliative for the disease. However, some particular breeds of sheep, such as the Gulf Coast Native from the Southern United States, have been shown to have developed special resistance to H. contortus.

Getting the full genome can help to tackle the problem and understand the resistance mechanism with an ease. Moreover, the genome could now provide a comprehensive understanding of how treatments against parasitic worms work and point to further new treatments and vaccines. By comparing the genome of the barber's pole worm with those of worms that have acquired drug resistance, researchers expect to reveal information about how and why resistance has occurred. Till now, researchers have uncovered essential information in the fight against drug resistance in worms.

Reference:

http://www.fwi.co.uk/articles/28/08/2013/140758/researchers-close-in-on-worm-resistance-in-sheep.htm

http://www.sciencedaily.com/releases/2013/08/130828103351.htm?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+sciencedaily%2Fplants_animals+(ScienceDaily%3A+Plants+%26+Animals+News)

Image source: Wikipedia

Link:

http://www.nytimes.com/2013/11/21/science/two-surprises-in-dna-of-boy-found-buried-in-siberia.html?_r=0

http://www.nature.com/nature/journal/vaop/ncurrent/full/nature12736.html

“In humans and most vertebrates the duplication events were older so there are fewer duplicated genes still present. Most of the duplicated genes get lost or modified so much that they are no longer recognizable as duplicates over time. In the trout and salmon we can see an earlier stage in the process and many duplicated genes are still present,” said Dr Gary Thorgaard of Washington State University, a co-author of the paper published in the journal Nature Communications.

Source:

http://www.sci-news.com/genetics/science-genome-rainbow-trout-01877.html

Source:

http://news.ufl.edu/2014/04/28/real-time-genome-sequencing-at-sea/

Source: http://www.eurekalert.org/pub_releases/2014-05/esoh-pco052914.php