<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/41107?offset=50</link>
	<atom:link href="https://bioinformaticsonline.com/related/41107?offset=50" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/1737/perl-in-a-day</guid>
	<pubDate>Sat, 10 Aug 2013 21:14:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/1737/perl-in-a-day</link>
	<title><![CDATA[Perl in a day !!]]></title>
	<description><![CDATA[<p>This pdf based tutorial in good resource to understand the basic of Perl in a day</p><p><a href="http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf">http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/view/2379</guid>
	<pubDate>Wed, 14 Aug 2013 15:43:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/view/2379</link>
	<title><![CDATA[Which Perl distribution should I choose for bioinformatics study : ActivePerl, Strawberry Perl, DWIM Perl, Citrus Perl ?]]></title>
	<description><![CDATA[<p>I'm new to bioinformatics and recently started learning Perl. I found several rival distributions available for Windows platform, which confuse me at the begining.</p><p>I google it and found that Strawberry comes with additional dev tools to compile CPAN modules if necessary. Whereas&nbsp;ActivePerl has a lot of prepackaged modules which are easier to install with PPM. In addition,&nbsp;DWIM Perl contains the standard Perl and a lot of extension and Citrus Perl is a binary distribution of Perl created for GUI application developers.&nbsp;</p><p>Now, I wonder what should I pick to get started?&nbsp;</p><p>Note: I am going to use BioPerl in near future.</p><p>http://dwimperl.com/</p><p>http://www.activestate.com/activeperl</p><p>http://www.citrusperl.com/</p><p>http://strawberryperl.com/</p>]]></description>
	<dc:creator>Manshi Raghubanshi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/5307/clean-the-fasta-file</guid>
	<pubDate>Thu, 03 Oct 2013 14:19:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/5307/clean-the-fasta-file</link>
	<title><![CDATA[Clean the FASTA file]]></title>
	<description><![CDATA[<p>Mostly FASTA file contain NNN characters, which can be replace by random A T G C character with this perl script. It also print the FASTA sequence name, N's counts, nucleotide count and percentage details at command prompt/standard output.</p><p>&nbsp;</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/5307" length="1408" type="text/x-perl" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/26627/scientist-computational-genomics-two-positions</guid>
  <pubDate>Sat, 12 Mar 2016 18:07:56 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist - Computational Genomics (Two Positions)]]></title>
  <description><![CDATA[
<p>ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these being the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture.</p>

<p>ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.</p>

<p>Responsibilities:Design efficient SQL queries for pulling large sequencing projects.<br />Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.<br />Develop and oversee a rapid and incremental software development and release schedule.<br />Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.<br />Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.<br />Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.<br />Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.<br />Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.<br />Assist in training of breeders in the CGIAR centers to use software developed.<br /> Personal Profile:</p>

<p>The applicant should have:</p>

<p>Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL<br />High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.<br />She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.<br />Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.<br />Ability to mentor colleagues in quality software development practices is desired.<br />Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.</p>

<p>More at http://www.icrisat.org/careers/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/31502/perl-way-to-check-if-an-array-contains-values</guid>
	<pubDate>Thu, 09 Mar 2017 17:17:01 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/31502/perl-way-to-check-if-an-array-contains-values</link>
	<title><![CDATA[Perl way to check if an array contains values]]></title>
	<description><![CDATA[<p><span>Perl is always is known for their flexibility (<span>There is more than one way to do it</span>). </span></p><p><span>Followings are the quick way to check if a value exist in an array.</span></p><blockquote><p><span>do_something </span><span>if</span><span> </span><span>'flour'</span><span> </span><span>~~</span><span> </span><span>@ingredients</span><span> &nbsp; </span><span># ~~ operand. &nbsp; BEWARE: it is broken.</span><span><br /><br />do_something </span><span>if</span><span> grep </span><span>{</span><span>$_ eq </span><span>'flour'</span><span>}</span><span> </span><span>@ingredients</span><span> </span><span># grep (slower than 'any')</span><span><br /><br />do_something </span><span>if</span><span> any </span><span>{</span><span>$_ eq </span><span>'flour'</span><span>}</span><span> </span><span>@ingredients</span><span> </span><span># List::MoreUtils / Util::Any</span><span><br /><br />do_something </span><span>if</span><span> any</span><span>(</span><span>@ingredients</span><span>)</span><span> eq </span><span>'flour'</span><span> &nbsp; </span><span># use syntax 'junction';</span><span><br /><br />do_something </span><span>if</span><span> </span><span>@ingredients</span><span>-&gt;</span><span>contains</span><span>(</span><span>'flour'</span><span>)</span><span> &nbsp; </span><span># added with autobox</span></p></blockquote>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33693/circleator</guid>
	<pubDate>Sun, 25 Jun 2017 18:04:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33693/circleator</link>
	<title><![CDATA[Circleator]]></title>
	<description><![CDATA[<p>The Charm City Circleator--or Circleator for short--is a Perl-based visualization tool developed at the&nbsp;<a href="http://igs.umaryland.edu/">Institute for Genome Sciences</a>&nbsp;in the University of Maryland's School of Medicine. Circleator produces circular plots of genome-associated data, like this one:</p>
<p><a href="https://camo.githubusercontent.com/0b414f050a7dcb672386932ee0cd83e5f42d2271/687474703a2f2f6a6f6e617468616e63726162747265652e6769746875622e696f2f436972636c6561746f722f696d616765732f43503030323732352d322d3432302e706e673f7261773d74727565" target="_blank"><img src="https://camo.githubusercontent.com/0b414f050a7dcb672386932ee0cd83e5f42d2271/687474703a2f2f6a6f6e617468616e63726162747265652e6769746875622e696f2f436972636c6561746f722f696d616765732f43503030323732352d322d3432302e706e673f7261773d74727565" alt="Sample Circleator image" title="Sample Circleator Image" style="border: 0px;"></a></p>
<p>Common uses of the tool include:</p>
<ul>
<li>Displaying the sequence and/or genes in a&nbsp;<a href="http://www.ncbi.nlm.nih.gov/genbank/">GenBank</a>&nbsp;flat file.</li>
<li>Highlighting differences and/or similarities in gene content between related organisms.</li>
<li>Comparing SNPs and indels between closely-related strains or serovars.</li>
<li>Comparing gene expression values across multiple samples or timepoints.</li>
<li>Visualizing coverage plots of RNA-Seq read alignments.</li>
</ul>
<h3><a href="https://github.com/jonathancrabtree/Circleator#key-features"></a>Key Features</h3>
<p>Circleator...</p>
<ul>
<li>Builds on&nbsp;<a href="http://www.bioperl.org/">BioPerl</a>&nbsp;and the input file formats that it supports, including:
<ul>
<li><a href="http://www.ncbi.nlm.nih.gov/genbank/">GenBank</a>&nbsp;flat files, GFF, FASTA</li>
</ul>
</li>
<li>Accepts a number of other commonly-used datatypes and file formats:
<ul>
<li><a href="http://bsr.igs.umaryland.edu/">BSR</a>&nbsp;and&nbsp;<a href="http://tandem.bu.edu/trf/trf.html">TRF</a>&nbsp;output,&nbsp;<a href="http://samtools.sourceforge.net/">SAM/BAM</a>&nbsp;files,&nbsp;<a href="http://vcftools.sourceforge.net/">VCF</a>-encoded SNPs, tab-delimited files</li>
</ul>
</li>
<li>Outputs publication-ready figures in the&nbsp;<a href="http://www.w3.org/Graphics/SVG/">SVG</a>&nbsp;(Scalable Vector Graphics) format.</li>
<li>Requires only a single configuration file whose layout mirrors that of the figure itself.
<ul>
<li>Predefined configuration files and "track" types are supplied for common datasets.</li>
<li>Advanced features allow limited analyses to be performed as a figure is drawn.</li>
</ul>
</li>
<li>Includes an extensive set of regression tests.</li>
<li>Offers a prototype web-based GUI (under the "Ringmaster" project.)</li>
</ul>
<p>https://github.com/jonathancrabtree/Circleator</p><p>Address of the bookmark: <a href="https://github.com/jonathancrabtree/Circleator" rel="nofollow">https://github.com/jonathancrabtree/Circleator</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</guid>
	<pubDate>Mon, 08 Jan 2018 22:32:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</link>
	<title><![CDATA[Frontend: Perl Web framework documentation - Andrej Sali Lab]]></title>
	<description><![CDATA[<p><span>The frontend is a set of Perl classes that displays the web interface, allowing a user to upload their input files, start a job, display a list of all jobs in the system, and get back job results. The main&nbsp;</span><a href="https://saliweb.readthedocs.io/en/latest/modules/frontend.html#saliwebfrontend" title="saliwebfrontend"><code><span>saliwebfrontend</span></code></a><span>&nbsp;class must be subclassed for each web service. This class is then used to display the web pages using a set of CGI scripts that are set up automatically by the build system.</span></p><p>Address of the bookmark: <a href="https://saliweb.readthedocs.io/en/latest/frontend.html" rel="nofollow">https://saliweb.readthedocs.io/en/latest/frontend.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>