<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/41459?offset=550</link>
	<atom:link href="https://bioinformaticsonline.com/related/41459?offset=550" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42987/public-databases-for-bioinformatics</guid>
	<pubDate>Tue, 23 Mar 2021 05:32:15 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42987/public-databases-for-bioinformatics</link>
	<title><![CDATA[Public Databases for Bioinformatics !]]></title>
	<description><![CDATA[<pre>https://www.nature.com/articles/s41467-020-17155-y<br><br>Server Infrastructure:

File Server:

dhara: Synology 3614 Storage Appliance
4 Core Xeon
108TB disk storage
10Gb ethernet to SCG3
Access atx: dhara:5000
Has btsync server (try it - its much better than dropbox)

Compute Servers:

nandi: Kundaje and Phi Server
24 intel cores
256GB RAM
500GB of SSD storage 
36TB RAID6 local storage
4 Intel Phi's (space for 4 more GPU's)


durga: Montgomery and sensitive data
24 intel cores
256GB RAM
500GB of SSD RAID0 storage 
60TB RAID6 local storage

mitra: Bassik and Web/DB Server
24 core
256GB RAM 
500GB of SSD RAID0 storage 
36TB RAID6 local storage

vayu: Kundaje GPU server
4 core
64GB RAM 
200GB of SSD storage 
8TB RAID10 local storage
4 Nvidia GTX 970 4GB GPUs

amold: Bickel and SGE server
32 AMD core
128GB RAM 
200GB of SSD storage 
12TB RAID5 local storage

wotan: Bickel and SGE server
64 AMD core
256GB RAM 
200GB of SSD storage 
12TB RAID5 local storage

Filesystem:

/users/$USER
default home directory
full backups nightly 
nfs mount to dhara
should store code, papers, and other highly processed data here

/mnt/data/
globally accessible data
should store common data here
e.g. genomes and indexes, annotations, ENCODE data  
if you dont want this to count towards your quote you must chown

/mnt/lab_data/$LAB/
lab accessible data
should store lab project data here 
e.g. ATAC-seq prediction data, enhancer prediction, motif calls

/srv/scratch/$USER
fast local storage
not backed up, but on raid and data will never be deleted
most analysis should be performed here

/srv/persistent/$USER
fast local storage
synced nightly, but not backed up
       ie if the hard drives fail or you delete something and notice 
       within 24 hours we can recover. Otherwise not. (vs home which is 
       properly backed up )  
intermediate analysis products that would be hard to recover should be stored here 
       e.g. stochastic analysis results that need to be kept so that paper 
       results can be reproduced

/srv/www/$LABNAME/
web accessible from mitra.stanford.edu
*NOT BACKED UP*

Some parallel programming patterns:

# gzip a bunch of files
parallel gzip -- *.FILESTOGZIP

# fork example in python:
(for more detailed examples look at 
 https://github.com/nboley/grit/ grit/lib/multiprocessing_utils.py)

import os
import time
import random

import multiprocessing

class ProcessSafeOPStream( object ):
    def __init__( self, writeable_obj ):
        self.writeable_obj = writeable_obj
        self.lock = multiprocessing.Lock()
        self.name = self.writeable_obj.name
        return
    
    def write( self, data ):
        self.lock.acquire()
        self.writeable_obj.write( data )
        self.writeable_obj.flush()
        self.lock.release()
        return
    
    def close( self ):
        self.writeable_obj.close()

def worker(queue, ofp):
    # Try without this
    random.seed()
    while True:
        i = queue.get()
        if i == 'FINISHED': return
        # simulate an expensive function
        x = random.random()
        time.sleep(x/10)
        print i, x
        ofp.write("%i\t%s\n" % (i, x))

NSIMS = 10000
NPROC = 25

# populate queue
todo = multiprocessing.Queue()
for i in xrange(NSIMS): todo.put(i)
for i in xrange(NPROC): todo.put('FINISHED')

ofp = ProcessSafeOPStream( open("output.txt", "w") )

pids = []
for i in xrange(NPROC):
    pid = os.fork()
    if pid == 0:
       worker(todo, ofp)
       os._exit(0)
    else:
       pids.append(pid)  

for pid in pids:
    os.waitpid(pid, 0)

ofp.close()

print "FINISHED"<br><br></pre>
<p>For use case 1 we obtained the following ENCODE and ROADMAP datasets&nbsp;<a href="https://www.encodeproject.org/files/ENCFF446WOD/@@download/ENCFF446WOD.bed.gz">https://www.encodeproject.org/files/ENCFF446WOD/@@download/ENCFF446WOD.bed.gz</a>,&nbsp;<a href="https://www.encodeproject.org/files/ENCFF546PJU/@@download/ENCFF546PJU.bam">https://www.encodeproject.org/files/ENCFF546PJU/@@download/ENCFF546PJU.bam</a>,&nbsp;<a href="https://www.encodeproject.org/files/ENCFF059BEU/@@download/ENCFF059BEU.bam">https://www.encodeproject.org/files/ENCFF059BEU/@@download/ENCFF059BEU.bam</a>. Blacklisted regions were obtained from&nbsp;<a href="http://mitra.stanford.edu/kundaje/akundaje/release/blacklists/hg38-human/hg38.blacklist.bed.gz">http://mitra.stanford.edu/kundaje/akundaje/release/blacklists/hg38-human/hg38.blacklist.bed.gz</a>. The human genome version hg38 was obtained from&nbsp;<a href="http://hgdownload.cse.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz">http://hgdownload.cse.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz</a>.</p>
<p>For use case 2 we used the set of narrowPeak files summarized in&nbsp;<a href="https://github.com/wkopp/janggu_usecases/tree/master/extra/urls.txt">https://github.com/wkopp/janggu_usecases/tree/master/extra/urls.txt</a>&nbsp;(archived version v1.0.1). The human genome version hg19 was obtained from&nbsp;<a href="http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/hg19.fa.gz">http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/hg19.fa.gz</a></p>
<p>For use case 3 we used the ENCODE datasets&nbsp;<a href="https://www.encodeproject.org/files/ENCFF591XCX/@@download/ENCFF591XCX.bam">https://www.encodeproject.org/files/ENCFF591XCX/@@download/ENCFF591XCX.bam</a>,&nbsp;<a href="https://www.encodeproject.org/files/ENCFF736LHE/@@download/ENCFF736LHE.bigWig">https://www.encodeproject.org/files/ENCFF736LHE/@@download/ENCFF736LHE.bigWig</a>,&nbsp;<a href="https://www.encodeproject.org/files/ENCFF177HHM/@@download/ENCFF177HHM.bam">https://www.encodeproject.org/files/ENCFF177HHM/@@download/ENCFF177HHM.bam</a>&nbsp;as we as the GENCODE annotation v29 from&nbsp;<a href="ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_29/gencode.v29.annotation.gtf.gz">ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_29/gencode.v29.annotation.gtf.gz</a>.</p><p>Address of the bookmark: <a href="http://mitra.stanford.edu/" rel="nofollow">http://mitra.stanford.edu/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34377/genomicus-genome-browser-that-enables-users-to-navigate-in-genomes-in-several-dimensions</guid>
	<pubDate>Sat, 18 Nov 2017 16:10:16 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34377/genomicus-genome-browser-that-enables-users-to-navigate-in-genomes-in-several-dimensions</link>
	<title><![CDATA[Genomicus: genome browser that enables users to navigate in genomes in several dimensions]]></title>
	<description><![CDATA[<p>Genomicus is a genome browser that enables users to navigate in genomes in several dimensions: linearly along chromosome axes, transversaly across different species, and chronologicaly along evolutionary time.</p>
<p>Once a query gene has been entered, it is displayed in its genomic context in parallel to the genomic context of all its orthologous and paralogous copies in all the other sequenced metazoan genomes. Moreover, Genomicus stores and displays the predicted ancestral genome structure in all the ancestral species within the phylogenetic range of interest.</p>
<p>All the data on extant species displayed in this browser are from&nbsp;<a href="http://www.ensembl.org/">Ensembl</a>.</p><p>Address of the bookmark: <a href="http://genomicus.biologie.ens.fr/genomicus-90.01/cgi-bin/search.pl" rel="nofollow">http://genomicus.biologie.ens.fr/genomicus-90.01/cgi-bin/search.pl</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34715/delta-a-new-web-based-3d-genome-visualization-and-analysis-platform</guid>
	<pubDate>Wed, 20 Dec 2017 08:49:55 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34715/delta-a-new-web-based-3d-genome-visualization-and-analysis-platform</link>
	<title><![CDATA[Delta: a new Web-based 3D genome visualization and analysis platform]]></title>
	<description><![CDATA[<p><em>Delta</em><span>&nbsp;is an integrative visualization and analysis platform to facilitate visually annotating and exploring the 3D physical architecture of genomes.&nbsp;</span><em>Delta</em><span>&nbsp;takes Hi-C or ChIA-PET contact matrix as input and predicts the topologically associating domains and chromatin loops in the genome. It then generates a physical 3D model which represents the plausible consensus 3D structure of the genome.&nbsp;</span><em>Delta</em><span>features a highly interactive visualization tool which enhances the integration of genome topology/physical structure with extensive genome annotation by juxtaposing the 3D model with diverse genomic assay outputs.</span></p>
<p>https://github.com/zhangzhwlab/delta</p><p>Address of the bookmark: <a href="https://github.com/zhangzhwlab/delta" rel="nofollow">https://github.com/zhangzhwlab/delta</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35429/list-of-visualization-tools-for-genome-alignments</guid>
	<pubDate>Fri, 02 Feb 2018 13:25:33 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35429/list-of-visualization-tools-for-genome-alignments</link>
	<title><![CDATA[List of visualization tools for genome alignments]]></title>
	<description><![CDATA[<p><span>Genome</span><span>&nbsp;browsers are useful not only for showing final results but also for improving analysis protocols, testing data quality, and generating result drafts. Its integration in analysis pipelines allows the optimization of parameters, which leads to better results. But sometime, we need publication ready figure of genomes. Following are the list of genome alignment visualization tools, which could be useful for analysis and&nbsp;interpretation of results:</span></p><p>ABySS Explorer</p><p>Interactive Java application that uses a novel graph-based representation to display a sequence assembly and associated metadata</p><p>http://www.bcgsc.ca/platform/bioinfo/software/abyss-explorer</p><p>BamView</p><p>Genome browser and annotation tool that allows visualization of sequence features, next-generation sequencing (NGS) data and the results of analyses within the context of the sequence, and also its six-frame translation</p><p>http://www.sanger.ac.uk/resources/software/artemis/</p><p>DNannotator&nbsp;</p><p>Annotation web toolkit for regional genomic sequences</p><p>http://bioapp.psych.uic.edu/DNannotator.htm</p><p>JVM&nbsp;</p><p>Java Visual Mapping tool for NGS reads</p><p>http://www.springer.com/cda/content/document/cda_downloaddocument/9789401792448-c2.pdf?SGWID=0-0-45-1487072-p176815501</p><p>LookSeq&nbsp;</p><p>Web-based visualization of sequences derived from multiple sequencing technologies. Low- or high-depth read pileups and easy visualization of putative single nucleotide and structural variation</p><p>http://lookseq.sourceforge.net</p><p>MagicViewer&nbsp;</p><p>Visualization of short read alignment, identification of genetic variation and association with annotation information of a reference genome</p><p>http://bioinformatics.zj.cn/magicviewer/</p><p>MapView&nbsp;</p><p>Alignments of huge-scale single-end and pair-end short reads</p><p>http://omictools.com/mapview-s1367.html</p><p>MultiPipMaker</p><p>Computes alignments of similar regions in two DNA sequences. The resulting alignments are summarized with a &lsquo;percent identity plot&rsquo; (pip)</p><p>http://pipmaker.bx.psu.edu/pipmaker/</p><p>PileLineGUI&nbsp;</p><p>Handling genome position files in NGS studies</p><p>http://sing.ei.uvigo.es/pileline/pilelinegui.html</p><p>SAMtools tview&nbsp;</p><p>Simple and fast text alignment viewer; NGS compatible</p><p>http://www.htslib.org/</p><p>SEWAL</p><p>Uses a locality-sensitive hashing algorithm to enumerate all unique sequences in an entire Illumina sequencing run</p><p>http://www.sourceforge.net/projects/sewal</p><p>STAR&nbsp;</p><p>A web-based integrated solution to management and visualization of sequencing data</p><p>http://wanglab.ucsd.edu/star/browser</p><p>SVA&nbsp;</p><p>Software for annotating and visualizing sequenced human genomes</p><p>http://www.svaproject.org</p><p>Viewer (IGV)&nbsp;</p><p>Visualization of large heterogeneous datasets, providing a smooth and intuitive user experience at all levels of genome resolution</p><p>https://www.broadinstitute.org/igv/</p><p>ZOOM Lite&nbsp;</p><p>NGS data mapping and visualization software</p><p>http://bioinfor.com/zoom/lite/</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35883/arcs-scaffolding-genome-drafts-with-linked-reads</guid>
	<pubDate>Tue, 06 Mar 2018 16:35:26 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35883/arcs-scaffolding-genome-drafts-with-linked-reads</link>
	<title><![CDATA[ARCS: scaffolding genome drafts with linked reads]]></title>
	<description><![CDATA[<p><span>ARCS, an application that utilizes the barcoding information contained in linked reads to further organize draft genomes into highly contiguous assemblies. We show how the contiguity of an ABySS&nbsp;</span><em>H.sapiens</em><span>genome assembly can be increased over six-fold, using moderate coverage (25-fold) Chromium data. We expect ARCS to have broad utility in harnessing the barcoding information contained in linked read data for connecting high-quality sequences in genome assembly drafts.</span></p><p>Address of the bookmark: <a href="https://github.com/bcgsc/ARCS/" rel="nofollow">https://github.com/bcgsc/ARCS/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Tue, 12 Jun 2018 08:14:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[P_RNA_scaffolder, a fast and accurate tool using paired-end RNA-sequencing reads to scaffold genomes. This tool aims to improve the completeness of both protein-coding and non-coding genes. After this tool was applied to scaffolding human contigs, the structures of both protein-coding genes and circular RNAs were almost completely recovered and equivalent to those in a complete genome, especially for long proteins and long circular RNAs.<p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</guid>
	<pubDate>Thu, 26 Jul 2018 04:58:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</link>
	<title><![CDATA[My commonly used commands in Bioinformatics]]></title>
	<description><![CDATA[<p>FYI, I've found it useful to use MUMmer to extract the specific changes that Racon makes, so I can evaluate them individually:</p><pre><code>minimap -t 24 assembly.fasta long_reads.fastq.gz | racon -t 24 long_reads.fastq.gz - assembly.fasta racon_assembly.fasta
nucmer -p nucmer assembly.fasta racon_assembly.fasta
show-snps -C -T -r nucmer.delta
</code></pre><p>This reports Racon's changes in a table. You can exclude indels with the&nbsp;<code>-I</code>&nbsp;option in&nbsp;<code>show-snps</code>.&nbsp;</p><p>This process (Racon -&gt; MUMmer -&gt; SNP table) solves the problem I originally raised in this issue. So as far as I'm concerned, you can close this issue (or keep it open if you still want to implement some kind of variant table).</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</guid>
	<pubDate>Fri, 09 Nov 2018 13:50:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</link>
	<title><![CDATA[ASCIIGenome: genome browser based on command line interface and designed for running from console terminals.]]></title>
	<description><![CDATA[<p><code>ASCIIGenome</code>&nbsp;is a genome browser based on command line interface and designed for running from console terminals.</p>
<p>Since&nbsp;<code>ASCIIGenome</code>&nbsp;does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like&nbsp;<a href="https://www.broadinstitute.org/igv/">IGV</a>.</p>
<p><span>Documentation</span>&nbsp;is at&nbsp;<a href="http://asciigenome.readthedocs.io/en/latest/">readthedocs/asciigenome</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/dariober/ASCIIGenome" rel="nofollow">https://github.com/dariober/ASCIIGenome</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</guid>
	<pubDate>Wed, 12 Dec 2018 08:33:41 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</link>
	<title><![CDATA[genoPlotR - plot gene and genome maps project!]]></title>
	<description><![CDATA[<p>genoPlotR is a R package to produce reproducible, publication-grade graphics of gene and genome maps. It allows the user to read from usual format such as protein table files and blast results, as well as home-made tabular files.</p>
<h3>Features</h3>
<ul>
<li>Linear representation of several segments of DNA</li>
<li>Comparisons represented by areas between the segments (like Artemis, for example)</li>
<li>Reads from common formats: Genbank, EMBL, blast, Mauve, and from user-generated tab files</li>
<li>Plot several subsegments of the same segment on the same line, separated by a //</li>
<li>Automatic or manual placement of the segments on the plot</li>
<li>Add annotations to all the lines</li>
<li>Create smart, automatic annotations for genomes, based on gene names</li>
<li>Add a user-generated tree</li>
<li>Add a global scale or a scale to each line</li>
<li>Use user-defined graphical functions to represent genes</li>
<li></li>
</ul><p>Address of the bookmark: <a href="http://genoplotr.r-forge.r-project.org/" rel="nofollow">http://genoplotr.r-forge.r-project.org/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>

</channel>
</rss>