<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/41493?offset=730</link>
	<atom:link href="https://bioinformaticsonline.com/related/41493?offset=730" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38385/decipher-a-software-toolset-for-deciphering-and-managing-biological-sequences-efficiently-using-the-r</guid>
	<pubDate>Sun, 09 Dec 2018 19:06:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38385/decipher-a-software-toolset-for-deciphering-and-managing-biological-sequences-efficiently-using-the-r</link>
	<title><![CDATA[DECIPHER; a software toolset for deciphering and managing biological sequences efficiently using the R]]></title>
	<description><![CDATA[<p><span>DECIPHER is a software toolset that can be used for deciphering and managing biological sequences efficiently using the&nbsp;</span><a href="http://www.r-project.org/">R</a><span>&nbsp;programming language. The&nbsp;</span><a href="http://www.r-project.org/">R</a><span>&nbsp;package is distributed as platform independent source code under the&nbsp;</span><a href="http://www.gnu.org/copyleft/gpl.html">GPL version 3 license</a><span>. Some functionality of the program is accessible online through web tools.</span></p>
<p><span style="font-size: medium; text-align: justify;">&nbsp;</span></p><p>Address of the bookmark: <a href="http://www2.decipher.codes/" rel="nofollow">http://www2.decipher.codes/</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40212/kalign-fast-multiple-sequence-alignment-program-for-biological-sequences</guid>
	<pubDate>Fri, 01 Nov 2019 00:20:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40212/kalign-fast-multiple-sequence-alignment-program-for-biological-sequences</link>
	<title><![CDATA[Kalign: fast multiple sequence alignment program for biological sequences.]]></title>
	<description><![CDATA[<p><span>Kalign is a fast multiple sequence alignment program for biological sequences.</span></p>
<p>Align sequences and output the alignment in MSF format:</p>
<pre><code>kalign -i BB11001.tfa -f msf  -o out.msf
</code></pre>
<p>Align sequences and output the alignment in clustal format:</p>
<pre><code>kalign -i BB11001.tfa -f clu -o out.clu
</code></pre>
<p>Re-align sequences in an existing alignment:</p>
<pre><code>kalign -i BB11001.msf  -o out.afa
</code></pre>
<p>Reformat existing alignment:</p>
<pre><code>kalign -i BB11001.msf -r afa -o out.afa</code></pre><p>Address of the bookmark: <a href="https://github.com/TimoLassmann/kalign" rel="nofollow">https://github.com/TimoLassmann/kalign</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43826/tiara-deep-learning-based-classification-system-for-eukaryotic-sequences</guid>
	<pubDate>Mon, 14 Mar 2022 23:02:11 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43826/tiara-deep-learning-based-classification-system-for-eukaryotic-sequences</link>
	<title><![CDATA[Tiara: deep learning-based classification system for eukaryotic sequences]]></title>
	<description><![CDATA[<p><span>With a large number of metagenomic datasets becoming available, eukaryotic metagenomics emerged as a new challenge. The proper classification of eukaryotic nuclear and organellar genomes is an essential step toward a better understanding of eukaryotic diversity.</span></p><p>Address of the bookmark: <a href="https://academic.oup.com/bioinformatics/article/38/2/344/6375939" rel="nofollow">https://academic.oup.com/bioinformatics/article/38/2/344/6375939</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44896/jaeger-an-accurate-and-fast-deep-learning-tool-to-detect-bacteriophage-sequences</guid>
	<pubDate>Sun, 31 Aug 2025 06:30:16 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44896/jaeger-an-accurate-and-fast-deep-learning-tool-to-detect-bacteriophage-sequences</link>
	<title><![CDATA[Jaeger : an accurate and fast deep-learning tool to detect bacteriophage sequences]]></title>
	<description><![CDATA[<p><span>Jaeger is a tool that utilizes homology-free machine learning to identify phage genome sequences that are hidden within metagenomes. It is capable of detecting both phages and prophages within metagenomic assemblies.</span></p><p>Address of the bookmark: <a href="https://github.com/MGXlab/Jaeger" rel="nofollow">https://github.com/MGXlab/Jaeger</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/20471/bioinformatics-scripts</guid>
	<pubDate>Thu, 22 Jan 2015 22:29:39 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/20471/bioinformatics-scripts</link>
	<title><![CDATA[Bioinformatics Scripts]]></title>
	<description><![CDATA[<p>Some of the useful bioinformatics scripts.</p>
<p>For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.</p>
<p>http://milkweedgenome.org/?q=scripts</p><p>Address of the bookmark: <a href="http://milkweedgenome.org/?q=scripts" rel="nofollow">http://milkweedgenome.org/?q=scripts</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/21982/which-bioinformatics-journals-do-you-follow</guid>
	<pubDate>Fri, 10 Apr 2015 12:10:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/21982/which-bioinformatics-journals-do-you-follow</link>
	<title><![CDATA[Which Bioinformatics Journals Do You Follow?]]></title>
	<description><![CDATA[<p><span><span>Which are your favorite bioinformatics journals? The ones that you check every month or so, or that you are subscribed to?</span></span></p>]]></description>
	<dc:creator>Tenzin Paul</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/22050/binc-sample-question-paper</guid>
	<pubDate>Thu, 16 Apr 2015 09:15:09 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/22050/binc-sample-question-paper</link>
	<title><![CDATA[BINC Sample Question Paper !!!]]></title>
	<description><![CDATA[<p>BINC sample question paper round THREE ...</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/22050" length="316" type="text/plain" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/23680/five-key-traits-to-seek-out-in-potential-bioinformatics-candidates</guid>
	<pubDate>Mon, 10 Aug 2015 12:53:50 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/23680/five-key-traits-to-seek-out-in-potential-bioinformatics-candidates</link>
	<title><![CDATA[Five key traits to seek out in potential bioinformatics candidates !!!]]></title>
	<description><![CDATA[<p>Genomics and proteomics data are being collected in bulk, but mostly, traditional biologist don&rsquo;t know what to do with it. Perhaps this is the reason why (not only this!!! ) computational biologist/bioinformatics scientists are hot commodities in the research world.</p><p>In fact, there are huge demands for expert biological data analyst. It&rsquo;s a fairly new &nbsp;(not exactly) hot area, these bioinformatician are invaluable because they know and understand the significance of biological data for your research and how you can use it for better understanding of biological problems.</p><p>The bioinformatics can discover biological patterns and stories in genomic and proteomics data. They can develop the pipeline needed to properly collect, store and analyse it.</p><p><img src="http://bioinformaticsonline.com/mod/photo/hire.gif" alt="image" style="border: 0px;"></p><p>Once your research group is ready to make a larger investment and hire a bioinformatician to gain a competitive edge, there are several key traits to seek out in potential candidates. The best bioinformatician are:</p><p>1. Highly Skilled - programming skills, experience with the biological software and tools.</p><p>The biological data won&rsquo;t illuminate much if the scientist analysing it doesn&rsquo;t possess practical programming skills, experience with the biological software and tools and a thorough understanding of basic biological stuff. A solid background in mathematics and statistics is also an indispensable trait.</p><p>2. Insight - Real vision, robust understanding and deep insight.</p><p>In order to hire the best bioinformatics and computational biologist scientist for your needs, it is always recommended and mostly practiced by the recruiters, to ask each contender to write and develop a sample script/presentation based on a specific set of data you provide. Then, explore the approaches used to deal with data provided and pick up those candidates who convey real vision, robust understanding and deep insight.</p><p>3. Energetic &ndash; Curiosity to explore</p><p>Mostly natural curiosity and enthusiasm for solving big biological problems coupled with an ability to transform data into a scientific stories may place one candidate above the rest. In addition to achieve that, the bioinformatician should be agile enough to quickly modify their methods to suit changes within a particular research.</p><p>4. Researcher &ndash; Publications</p><p>Look for someone who has a keen sense and understanding of concern biological problems. You can judge it by looking at previously published papers and data. It is always recommended to have a look at GitHub and other repository for codes written by her/him.</p><p>5. Impressive communicator - Insight that can&rsquo;t be expressed is worthless.</p><p>Good bioinformatics scientists are able to uncover biological patterns and are willing to explain those patterns in clear and helpful ways through thoughtful and open communication. In other words, they should must have good scientific writing skills. A computational biologis/bioinformatician&nbsp; should know how to present the data and tell a scientific story through numbers/images.</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>