BOL: Related items

SISRS: Site Identification from Short Read Sequences

Abhimanyu Singh — Wed, 28 Nov 2018 08:56:03 -0600

Next-gen sequence data such as Illumina HiSeq reads. Data must be sorted into folders by taxon (e.g. species or genus). Paired reads in fastq format must be specified by _R1 and _R2 in the (otherwise identical) filenames. Paired and unpaired reads must have a fastq file extension.

Address of the bookmark: https://github.com/rachelss/SISRS

minimap2: A versatile pairwise aligner for genomic and spliced nucleotide sequences

Jit — Wed, 20 Jun 2018 07:55:29 -0500

git clone https://github.com/lh3/minimap2 cd minimap2 && make # long sequences against a reference genome ./minimap2 -a test/MT-human.fa test/MT-orang.fa > test.sam # create an index first and then map ./minimap2 -d MT-human.mmi test/MT-human.fa ./minimap2 -a MT-human.mmi test/MT-orang.fa > test.sam # use presets (no test data) ./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio genomic reads ./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads ./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads ./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads ./minimap2 -ax splice -k14 -uf ref.fa reads.fa > aln.sam # Nanopore Direct RNA-seq ./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment ./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap ./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap # man page for detailed command line options man ./minimap2.1

Address of the bookmark: https://github.com/lh3/minimap2

DECIPHER; a software toolset for deciphering and managing biological sequences efficiently using the R

BioStar — Sun, 09 Dec 2018 19:06:17 -0600

DECIPHER is a software toolset that can be used for deciphering and managing biological sequences efficiently using the R programming language. The R package is distributed as platform independent source code under the GPL version 3 license. Some functionality of the program is accessible online through web tools.

Address of the bookmark: http://www2.decipher.codes/

Kalign: fast multiple sequence alignment program for biological sequences.

BioStar — Fri, 01 Nov 2019 00:20:41 -0500

Kalign is a fast multiple sequence alignment program for biological sequences.

Align sequences and output the alignment in MSF format:

kalign -i BB11001.tfa -f msf  -o out.msf

Align sequences and output the alignment in clustal format:

kalign -i BB11001.tfa -f clu -o out.clu

Re-align sequences in an existing alignment:

kalign -i BB11001.msf  -o out.afa

Reformat existing alignment:

kalign -i BB11001.msf -r afa -o out.afa

Address of the bookmark: https://github.com/TimoLassmann/kalign

Tiara: deep learning-based classification system for eukaryotic sequences

Rahul Nayak — Mon, 14 Mar 2022 23:02:11 -0500

With a large number of metagenomic datasets becoming available, eukaryotic metagenomics emerged as a new challenge. The proper classification of eukaryotic nuclear and organellar genomes is an essential step toward a better understanding of eukaryotic diversity.

Address of the bookmark: https://academic.oup.com/bioinformatics/article/38/2/344/6375939

Jaeger : an accurate and fast deep-learning tool to detect bacteriophage sequences

LEGE — Sun, 31 Aug 2025 06:30:16 -0500

Jaeger is a tool that utilizes homology-free machine learning to identify phage genome sequences that are hidden within metagenomes. It is capable of detecting both phages and prophages within metagenomic assemblies.

Address of the bookmark: https://github.com/MGXlab/Jaeger

Bioinformatics Scripts

Jit — Thu, 22 Jan 2015 22:29:39 -0600

Some of the useful bioinformatics scripts.

For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.

http://milkweedgenome.org/?q=scripts

Address of the bookmark: http://milkweedgenome.org/?q=scripts

Which Bioinformatics Journals Do You Follow?

Tenzin Paul — Fri, 10 Apr 2015 12:10:21 -0500

Which are your favorite bioinformatics journals? The ones that you check every month or so, or that you are subscribed to?

BINC Sample Question Paper !!!

Jitendra Narayan — Thu, 16 Apr 2015 09:15:09 -0500

BINC sample question paper round THREE ...

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}