Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!

Caretta, a multiple structure alignment suite meant for homologous but sequentially divergent protein families which consistently returns accurate alignments with a higher coverage than current state-of-the-art tools. Caretta is available as a GUI and command-line application and additionally outputs an aligned structure feature matrix for a given set of input structures, which can readily be used in downstream steps for supervised or unsupervised machine learning. 

Address of the bookmark: http://www.bioinformatics.nl/caretta/

More at http://www.ncbi.nlm.nih.gov/news/06-16-2015-blast-plus-update/?

More at http://sequenceserver.com.

Address of the bookmark: https://github.com/wurmlab/sequenceserver

Magic-BLAST incorporates within the NCBI BLAST code framework ideas developed in the NCBI Magic pipeline, in particular hit extensions by local walk and jump (http://www.ncbi.nlm.nih.gov/pubmed/26109056), and recursive clipping of mismatches near the edges of the reads, which avoids accumulating artefactual mismatches near splice sites and is needed to distinguish short indels from substitutions near the edges.

Address of the bookmark: https://ncbi.github.io/magicblast/

Address of the bookmark: https://ncbi.github.io/magicblast/

Online version and downloadable software package for offline use (source code in PERL) freely available at http://bat.ina.certh.gr/tools/circoletto/

Contact:ndarz@certh.gr

Address of the bookmark: http://tools.bat.infspire.org/circoletto/

https://github.com/IGS/twinblast

https://mra.asm.org/content/8/35/e00842-19

Address of the bookmark: https://github.com/IGS/twinblast