<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/41592?offset=430</link>
	<atom:link href="https://bioinformaticsonline.com/related/41592?offset=430" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</guid>
	<pubDate>Thu, 26 Jul 2018 04:58:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</link>
	<title><![CDATA[My commonly used commands in Bioinformatics]]></title>
	<description><![CDATA[<p>FYI, I've found it useful to use MUMmer to extract the specific changes that Racon makes, so I can evaluate them individually:</p><pre><code>minimap -t 24 assembly.fasta long_reads.fastq.gz | racon -t 24 long_reads.fastq.gz - assembly.fasta racon_assembly.fasta
nucmer -p nucmer assembly.fasta racon_assembly.fasta
show-snps -C -T -r nucmer.delta
</code></pre><p>This reports Racon's changes in a table. You can exclude indels with the&nbsp;<code>-I</code>&nbsp;option in&nbsp;<code>show-snps</code>.&nbsp;</p><p>This process (Racon -&gt; MUMmer -&gt; SNP table) solves the problem I originally raised in this issue. So as far as I'm concerned, you can close this issue (or keep it open if you still want to implement some kind of variant table).</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</guid>
	<pubDate>Fri, 26 Oct 2018 08:25:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</link>
	<title><![CDATA[MITOS: improved de novo metazoan mitochondrial genome annotation]]></title>
	<description><![CDATA[<p><span>Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.</span></p><p>Address of the bookmark: <a href="http://mitos.bioinf.uni-leipzig.de/index.py" rel="nofollow">http://mitos.bioinf.uni-leipzig.de/index.py</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</guid>
	<pubDate>Fri, 09 Nov 2018 13:50:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</link>
	<title><![CDATA[ASCIIGenome: genome browser based on command line interface and designed for running from console terminals.]]></title>
	<description><![CDATA[<p><code>ASCIIGenome</code>&nbsp;is a genome browser based on command line interface and designed for running from console terminals.</p>
<p>Since&nbsp;<code>ASCIIGenome</code>&nbsp;does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like&nbsp;<a href="https://www.broadinstitute.org/igv/">IGV</a>.</p>
<p><span>Documentation</span>&nbsp;is at&nbsp;<a href="http://asciigenome.readthedocs.io/en/latest/">readthedocs/asciigenome</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/dariober/ASCIIGenome" rel="nofollow">https://github.com/dariober/ASCIIGenome</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38475/purge-haplotigs-pipeline-to-help-with-curating-heterozygous-diploid-genome-assemblies</guid>
	<pubDate>Mon, 17 Dec 2018 03:17:20 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38475/purge-haplotigs-pipeline-to-help-with-curating-heterozygous-diploid-genome-assemblies</link>
	<title><![CDATA[Purge Haplotigs: Pipeline to help with curating heterozygous diploid genome assemblies]]></title>
	<description><![CDATA[<p>Some parts of a genome may have a very high degree of heterozygosity. This causes contigs for both haplotypes of that part of the genome to be assembled as separate primary contigs, rather than as a contig and an associated haplotig. This can be an issue for downstream analysis whether you're working on the haploid or phased-diploid assembly.</p>
<p><span>Identify pairs of contigs that are syntenic and move one of them to the haplotig 'pool'. The pipeline uses mapped read coverage and Minimap2 alignments to determine which contigs to keep for the haploid assembly. Dotplots are optionally produced for all flagged contig matches, juxtaposed with read-coverage, to help the user determine the proper assignment of any remaining ambiguous contigs. The pipeline will run on either a haploid assembly (i.e. Canu, FALCON or FALCON-Unzip primary contigs) or on a phased-diploid assembly (i.e. FALCON-Unzip primary contigs + haplotigs). Here are&nbsp;</span><a href="https://bitbucket.org/mroachawri/purge_haplotigs/wiki/Examples">two examples</a><span>&nbsp;of how Purge Haplotigs can improve a haploid and diploid assembly.</span></p><p>Address of the bookmark: <a href="https://bitbucket.org/mroachawri/purge_haplotigs" rel="nofollow">https://bitbucket.org/mroachawri/purge_haplotigs</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38672/ltr-retriever-accurately-identifies-and-annotates-ltr-retrotransposons-and-use-lai-to-evaluates-the-continuity-of-genome-assemblies</guid>
	<pubDate>Sun, 13 Jan 2019 07:14:31 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38672/ltr-retriever-accurately-identifies-and-annotates-ltr-retrotransposons-and-use-lai-to-evaluates-the-continuity-of-genome-assemblies</link>
	<title><![CDATA[LTR_retriever: accurately identifies and annotates LTR retrotransposons and use LAI to evaluates the continuity of genome assemblies.]]></title>
	<description><![CDATA[<p>LTR_retriever is a command line program (in Perl) for accurate identification of LTR retrotransposons (LTR-RTs) from outputs of LTRharvest, LTR_FINDER, and/or MGEScan-LTR and generating non-redundant LTR-RT library for genome annotations.</p>
<p>By default, the program will generate whole-genome LTR-RT annotation and the LTR Assembly Index (LAI) for evaluations of the assembly continuity of the input genome. Users can also run LAI separately (see&nbsp;<code>Usage</code>).</p><p>Address of the bookmark: <a href="https://github.com/oushujun/LTR_retriever" rel="nofollow">https://github.com/oushujun/LTR_retriever</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40416/5700-year-old-human-genome</guid>
	<pubDate>Thu, 19 Dec 2019 11:22:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40416/5700-year-old-human-genome</link>
	<title><![CDATA[5700 year-old human genome !]]></title>
	<description><![CDATA[<p>A Landmark in genomics, scientists have done something that hasn't been done ever.</p><p>Scientists have reconstructed the genome of an ancient human who lived nearly 5,700 years ago in Southern Denmark from the birch pitch- an ancient tar-like substance.</p><p>By sequencing the sample, researchers not only discovered the ancient human DNA but also microbial DNA reflecting the oral microbiome of the person who chewed the pitch, along with plant and animal DNA that could be the recent<span> meal she might have consumed.</span></p><p><span style="font-size: 12.8px;">The DNA sample is comparable in quality to well-preserved teeth and skull bones. The DNA suggests that the chewer was a female, most likely with dark skin, dark brown hair and blue eyes.</span></p><div><p><a href="https://www.nature.com/articles/s41467-019-13549-9?fbclid=IwAR0FPk0Cl25YjHVdcfK4tqFhCsPx00SCSMUwlU6zNwMDNrKi1QynwtJKDfE" target="_blank">https://www.nature.com/articles/s41467-019-13549-9</a></p><p><img src="https://i.kinja-img.com/gawker-media/image/upload/c_scale,f_auto,fl_progressive,q_80,w_800/ykcvh491evenyvlrjb9r.jpg" width="800" height="450" alt="image" style="border: 0px;"></p><p>Artistic reconstruction. (Tom Bj&ouml;rklund)</p><p>More at&nbsp;<a href="https://gizmodo.com/scientists-reconstruct-lola-after-finding-her-dna-in-1840481633">https://gizmodo.com/scientists-reconstruct-lola-after-finding-her-dna-in-1840481633</a></p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40789/complete-genome-sequence-of-wuhan-seafood-market-pneumonia-virus-is-out</guid>
	<pubDate>Fri, 31 Jan 2020 02:36:59 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40789/complete-genome-sequence-of-wuhan-seafood-market-pneumonia-virus-is-out</link>
	<title><![CDATA[Complete genome sequence of Wuhan seafood market pneumonia virus is out !]]></title>
	<description><![CDATA[<p>Wuhan-Hu-1 claimed at least 40 lives and infected at least 1300 others in China. Cases are now being reported from Thailand, Singapore, Malaysia, South Korea, Japan, Vietnam, Nepal, France, Australia and even as far as the US.&nbsp;On Jan 10 2020, while news of the first fatality was barely trickling in, the <a href="https://www.ncbi.nlm.nih.gov/nuccore/MN908947">29,903 letters</a> constituting the viral genome from an affected individual in Wuhan had already been elucidated (even though a few corrections were made subsequently). All the viral genome sequences from affected individuals are very very close to each other. Several are identical and none has more than 5 differences (99.983% similarity). This strongly suggests that transmission into humans came from a single pointed source and happened very recently, between Sep-Dec 2019.</p><p>Check out the detail at https://www.ncbi.nlm.nih.gov/nuccore/MN908947</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/41300/china%E2%80%99s-bgi-says-it-can-sequence-a-genome-for-just-100</guid>
	<pubDate>Sat, 29 Feb 2020 04:49:43 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/41300/china%E2%80%99s-bgi-says-it-can-sequence-a-genome-for-just-100</link>
	<title><![CDATA[China’s BGI says it can sequence a genome for just $100]]></title>
	<description><![CDATA[<p>Using technology originally acquired in the US, the Chinese gene giant BGI Group says it will make genome sequencing cheaper than ever, breaking the $100 barrier for the first time.</p><p>The Shenzhen company says the low cost will be possible with an &ldquo;extreme&rdquo; DNA sequencing system it plans to offer that is capable of decoding the genomes of 100,000 people a year.</p><p>Ref:&nbsp;<a href="https://www.technologyreview.com/s/615289/china-bgi-100-dollar-genome/">https://www.technologyreview.com/s/615289/china-bgi-100-dollar-genome/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41991/sequence-ontology-bioinformatics-analysis-soba-tool-to-provide-a-simple-statistical-and-graphical-summary-of-an-annotated-genome</guid>
	<pubDate>Wed, 22 Jul 2020 10:11:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41991/sequence-ontology-bioinformatics-analysis-soba-tool-to-provide-a-simple-statistical-and-graphical-summary-of-an-annotated-genome</link>
	<title><![CDATA[Sequence Ontology Bioinformatics Analysis (SOBA) tool to provide a simple statistical and graphical summary of an annotated genome]]></title>
	<description><![CDATA[<p><span>We have developed the Sequence Ontology Bioinformatics Analysis (SOBA) tool to provide a simple statistical and graphical summary of an annotated genome. We envisage its use during annotation jamborees, genome comparison and for use by developers for rapid feedback during annotation software development and testing. SOBA also provides annotation consistency feedback to ensure correct use of terminology within annotations, and guides users to add new terms to the Sequence Ontology when required. SOBA is available at http://www.sequenceontology.org/cgi-bin/soba.cgi.</span></p>
<p><span>More at <a href="https://pubmed.ncbi.nlm.nih.gov/20494974/">https://pubmed.ncbi.nlm.nih.gov/20494974/</a></span></p><p>Address of the bookmark: <a href="http://www.sequenceontology.org/cgi-bin/soba.cgi" rel="nofollow">http://www.sequenceontology.org/cgi-bin/soba.cgi</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

</channel>
</rss>