<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/41675?offset=20</link>
	<atom:link href="https://bioinformaticsonline.com/related/41675?offset=20" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35571/medusa-a-multi-draft-based-scaffolder</guid>
	<pubDate>Wed, 14 Feb 2018 02:49:00 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35571/medusa-a-multi-draft-based-scaffolder</link>
	<title><![CDATA[MeDuSa: a multi-draft based scaffolder]]></title>
	<description><![CDATA[<p><span>MeDuSa (Multi-Draft based Scaffolder), an algorithm for genome scaffolding. MeDuSa exploits information obtained from a set of (draft or closed) genomes from related organisms to determine the correct order and orientation of the contigs. MeDuSa formalises the scaffolding problem by means of a combinatorial optimisation formulation on graphs and implements an efficient constant factor approximation algorithm to solve it. In contrast to currently used scaffolders, it does not require either prior knowledge on the microrganisms dataset under analysis (e.g. their phylogenetic relationships) or the availability of paired end read libraries.&nbsp;</span></p><p>Address of the bookmark: <a href="https://github.com/combogenomics/medusa" rel="nofollow">https://github.com/combogenomics/medusa</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36857/%E2%80%9Cone-code-to-find-them-all%E2%80%9D-a-perl-tool-to-conveniently-parse-repeatmasker-output-files</guid>
	<pubDate>Mon, 04 Jun 2018 03:45:15 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36857/%E2%80%9Cone-code-to-find-them-all%E2%80%9D-a-perl-tool-to-conveniently-parse-repeatmasker-output-files</link>
	<title><![CDATA[“One code to find them all”: a perl tool to conveniently parse RepeatMasker output files]]></title>
	<description><![CDATA[One code to find them all is a set of perl scripts to extract useful information from RepeatMasker about transposable elements, retrieve their sequences and get some quantitative information.

Assemble RepeatMasker hits into complete TE copies, including LTR-retrotransposon
Retrieve corresponding TE sequences, and flanking sequences, from the local fasta files
Compute summary statistics for each TE family (number of TE copies, genome coverage...)
Ambiguous cases such as nested TE can be assembled into copies automatically or manually
Allow for working with a TE user-defined library
Allow for working with only a user-chosen set of TE families


http://doua.prabi.fr/software/one-code-to-find-them-all<p>Address of the bookmark: <a href="http://doua.prabi.fr/software/one-code-to-find-them-all" rel="nofollow">http://doua.prabi.fr/software/one-code-to-find-them-all</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/3868/next-generation-sequencing-ngs-tutorials</guid>
	<pubDate>Sat, 24 Aug 2013 06:01:37 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/3868/next-generation-sequencing-ngs-tutorials</link>
	<title><![CDATA[Next Generation Sequencing (NGS) Tutorials]]></title>
	<description><![CDATA[<p>Institute of computational biomedicine, Cornell University provide an NGS workshop tutorial at&nbsp;<a href="http://chagall.med.cornell.edu/NGScourse/">http://chagall.med.cornell.edu/NGScourse/</a>&nbsp;</p>
<p>You can also add your favourite NGS educational material, or workshop tutorial by commenting on this bookmarks for user benefit.&nbsp;</p>
<p>Understanding the basics of genome sequencing:</p>
<p>Tutorial by Luke Jostins.</p>
<p>http://www.genetic-inference.co.uk/blog/2009/04/basics-sequencing-dna-part-1/</p>
<p>http://www.genetic-inference.co.uk/blog/2009/08/basics-sequencing-dna-part-2/</p>
<p>A window into third-generation sequencing</p>
<p>http://hmg.oxfordjournals.org/content/19/R2/R227.full.pdf</p>
<p>==============================================</p>
<p>NGS data analysis pipelines</p>
<ul>
<li><strong>Detecting and annotating genetic variations using the HugeSeq pipeline</strong>&nbsp; DOI: <a href="http://dx.doi.org/10.1038/nbt.2134">10.1038/nbt.2134</a></li>
<li><strong> NARWHAL, a primary analysis pipeline for NGS data</strong> <a href="http://bioinformatics.oxfordjournals.org/cgi/content/abstract/28/2/284?etoc">http://bioinformatics.oxfordjournals.org/cgi/content/abstract/28/2/284?etoc</a></li>
<li><strong>RseqFlow: Workflows for RNA-Seq data analysis</strong>&nbsp; DOI: <a href="http://dx.doi.org/10.1093/bioinformatics/btr441">10.1093/bioinformatics/btr441</a></li>
<li><strong>ngs_backbone: a pipeline for read cleaning, mapping and SNP calling using Next Generation Sequence</strong>&nbsp;&nbsp;<a href="http://dx.doi.org/10.1186/1471-2164-12-285">10.1186/1471-2164-12-285</a></li>
<li><strong>A framework for variation discovery and genotyping using next-generation DNA sequencing data</strong>&nbsp; PubMed: <a href="http://www.ncbi.nlm.nih.gov/pubmed/21478889">21478889</a></li>
<li><strong>SNiPlay: a web-based tool for detection, management and analysis of SNPs. Application to grapevine diversity projects</strong>&nbsp; DOI: <a href="http://dx.doi.org/10.1186/1471-2105-12-134">10.1186/1471-2105-12-134</a> Abstract: <a href="http://www.biomedcentral.com/1471-2105/12/134/abstract">http://www.biomedcentral.com/1471-2105/12/134/abstract</a></li>
<li><strong>WEP: a high-performance analysis pipeline for whole-exome data&nbsp;</strong>http://www.biomedcentral.com/1471-2105/14/S7/S11</li>
<li><strong>DDBJ read annotation pipeline: a cloud computing-based pipeline for high-throughput analysis of next-generation sequencing data.&nbsp;</strong>http://www.ncbi.nlm.nih.gov/pubmed/23657089</li>
<li><strong>GATK: a Toolkit for Genome Analysis&nbsp;</strong>http://www.broadinstitute.org/gatk/</li>
<li><strong>Metagenomics</strong>:http://www.nbic.nl/education/nbic-phd-school/course-schedule/ngsmetagenomics/</li>
<li><strong>RNASeq</strong>:http://www.nbic.nl/education/nbic-phd-school/course-schedule/ngsrnaseq/</li>
<li><strong>Bioinformatics and Seq courses</strong>:&nbsp;http://www.isb-sib.ch/training/training-activities-schedule/archive-2013.html</li>
<li><strong>Variant Detection (Model organism) Advanced tutorial</strong> https://docs.google.com/document/pub?id=1CuKkKylVDb03tnN7RSWl5EUzleetn0ctjmvaidPKLxM</li>
<li><strong>Variant Detection Introductory tutorial</strong> https://docs.google.com/document/pub?id=1ZRzrjjOCvtAu3m-IKL-rbJ1f4On60dDL_IEwG7oejdI</li>
<li><strong>Microbial de novo Assembly for Illumina Data Introductory tutorial</strong> https://docs.google.com/document/pub?id=1N3AB9ptISUu4zULqe1kXpVF0BDyGb5f5yzxWSJd_WNM</li>
<li><strong>RNAseq Differential Gene Expression Introductory tutorial</strong> https://docs.google.com/document/pub?id=1KbTiBHtvHLfPRZ39AY3uriazrINA8TJzgjjwn1zPP7Y</li>
</ul>
<blockquote>
<p>" Please add your favourite NGS link below in comment section for the benefit of bioinformatics community ".&nbsp;</p>
</blockquote><p>Address of the bookmark: <a href="http://chagall.med.cornell.edu/NGScourse/" rel="nofollow">http://chagall.med.cornell.edu/NGScourse/</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26306/busco</guid>
	<pubDate>Sun, 07 Feb 2016 16:02:39 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26306/busco</link>
	<title><![CDATA[BUSCO]]></title>
	<description><![CDATA[<p>Assessing genome assembly and annotation completeness with Benchmarking Universal Single-Copy Orthologs</p>
<p>More at http://busco.ezlab.org/</p><p>Address of the bookmark: <a href="http://busco.ezlab.org/" rel="nofollow">http://busco.ezlab.org/</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/28844/teannot</guid>
	<pubDate>Thu, 18 Aug 2016 10:02:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/28844/teannot</link>
	<title><![CDATA[TEannot]]></title>
	<description><![CDATA[<p>We advise to run first the TEdenovo pipeline but it is not compulsory. We suppose you begin by running the TEannot pipeline on the example provided in the directory "db/" rather than directly on your own genomic sequences. Thus, from now on, the project name is "DmelChr4".</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://urgi.versailles.inra.fr/Tools/REPET/TEannot-tuto" rel="nofollow">https://urgi.versailles.inra.fr/Tools/REPET/TEannot-tuto</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34394/tulip-the-uncorrected-long-read-itegration-pipeline</guid>
	<pubDate>Thu, 23 Nov 2017 09:30:01 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34394/tulip-the-uncorrected-long-read-itegration-pipeline</link>
	<title><![CDATA[TULIP - The Uncorrected Long read Itegration Pipeline]]></title>
	<description><![CDATA[<p>#Running TULIP (The Uncorrected Long-read Integration Process), version 0.4 late 2016 (European eel)</p>
<p>TULIP currently consists of to Perl scripts, tulipseed.perl and tulipbulb.perl. These are very much intended as prototypes, and additional components and/or implementations are likely to follow.&nbsp;<br>Tulipseed takes as input alignments files of long reads to sparse short seeds, and outputs a graph and scaffold structures. Tulipbulb adds long read sequencing data to these.</p>
<p>&nbsp;</p>
<p>https://github.com/Generade-nl/TULIP</p><p>Address of the bookmark: <a href="https://github.com/Generade-nl/TULIP" rel="nofollow">https://github.com/Generade-nl/TULIP</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38475/purge-haplotigs-pipeline-to-help-with-curating-heterozygous-diploid-genome-assemblies</guid>
	<pubDate>Mon, 17 Dec 2018 03:17:20 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38475/purge-haplotigs-pipeline-to-help-with-curating-heterozygous-diploid-genome-assemblies</link>
	<title><![CDATA[Purge Haplotigs: Pipeline to help with curating heterozygous diploid genome assemblies]]></title>
	<description><![CDATA[<p>Some parts of a genome may have a very high degree of heterozygosity. This causes contigs for both haplotypes of that part of the genome to be assembled as separate primary contigs, rather than as a contig and an associated haplotig. This can be an issue for downstream analysis whether you're working on the haploid or phased-diploid assembly.</p>
<p><span>Identify pairs of contigs that are syntenic and move one of them to the haplotig 'pool'. The pipeline uses mapped read coverage and Minimap2 alignments to determine which contigs to keep for the haploid assembly. Dotplots are optionally produced for all flagged contig matches, juxtaposed with read-coverage, to help the user determine the proper assignment of any remaining ambiguous contigs. The pipeline will run on either a haploid assembly (i.e. Canu, FALCON or FALCON-Unzip primary contigs) or on a phased-diploid assembly (i.e. FALCON-Unzip primary contigs + haplotigs). Here are&nbsp;</span><a href="https://bitbucket.org/mroachawri/purge_haplotigs/wiki/Examples">two examples</a><span>&nbsp;of how Purge Haplotigs can improve a haploid and diploid assembly.</span></p><p>Address of the bookmark: <a href="https://bitbucket.org/mroachawri/purge_haplotigs" rel="nofollow">https://bitbucket.org/mroachawri/purge_haplotigs</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44168/environmental-genomics-group-scilifelabkth-stockholm</guid>
	<pubDate>Thu, 01 Dec 2022 01:12:43 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44168/environmental-genomics-group-scilifelabkth-stockholm</link>
	<title><![CDATA[Environmental Genomics Group SciLifeLab/KTH Stockholm]]></title>
	<description><![CDATA[<p>Useful Metagenomics resources</p><p>Address of the bookmark: <a href="https://github.com/envgen" rel="nofollow">https://github.com/envgen</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44675/variant-calling-pipeline</guid>
	<pubDate>Sat, 19 Oct 2024 12:23:40 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44675/variant-calling-pipeline</link>
	<title><![CDATA[Variant Calling Pipeline]]></title>
	<description><![CDATA[<p dir="auto">The&nbsp;<a href="https://github.com/Tom-Jenkins/maerl-wgs-pipelines/blob/main/src/variantcalling.nf"><code>variantcalling.nf</code></a>&nbsp;nextflow script will take any number of samples with paired-end reads in FASTQ format, map reads using Bowtie2, process BAM files, and finally call variants using BCFtools v1.21 and/or Freebayes v1.3.6. If part of the pipeline is unsuccessful for a sample then these errors are ignored.</p>
<p dir="auto">Pipeline flowchart:</p>
<div dir="auto">
<div dir="auto">
<div>&nbsp;</div>
<div></div>
</div>
<div>&nbsp;</div>
<div dir="auto">
<h2 dir="auto">Dependencies (version tested)</h2>
<a href="https://github.com/Tom-Jenkins/nextflow-pipelines/blob/main/docs/variant-calling.md#dependencies-version-tested"></a></div>
<ul dir="auto">
<li>Nextflow (24.04.4)</li>
<li>Java (18.0.2.1)</li>
<li>Python (3.10)</li>
<li>Perl (5.32.1)</li>
<li>Bowtie2 (2.5.3)</li>
<li>SAMtools (1.19.2)</li>
<li>GATK4 (4.5)</li>
<li>BCFtools (1.21)</li>
<li>Freebayes (1.3.6)</li>
</ul>
</div><p>Address of the bookmark: <a href="https://github.com/Tom-Jenkins/nextflow-pipelines/blob/main/docs/variant-calling.md" rel="nofollow">https://github.com/Tom-Jenkins/nextflow-pipelines/blob/main/docs/variant-calling.md</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>

</channel>
</rss>