https://www.genome.gov/event-calendar/perspectives-in-comparative-genomics-and-evolution

Address of the bookmark: https://www.genome.gov/event-calendar/perspectives-in-comparative-genomics-and-evolution

Address of the bookmark: https://github.com/envgen

Effective July 10, 2023, NCBI’s Assembly and Genome record pages now redirect to new NCBI Datasets pages. As previously announced, these updates are part of our ongoing effort to modernize and improve your user experience. NCBI Datasets is a new resource that makes it easier to find and download genome data.   

The following pages have been updated:

• The NCBI Assembly record pages now redirect to the new NCBI Datasets Genome record pages that describe assembled genomes and provide links to related NCBI tools such as Genome Data Viewer and BLAST.  
• The NCBI Genome record pages now redirect to the NCBI Datasets Taxonomy record pages that provide a taxonomy-focused portal to genes, genomes, and additional NCBI resources.   

During this transition, you will have the option to return to the legacy Genome and Assembly record pages. We will remove the legacy pages in early 2024.  

The Power of Evo 2: AI Meets DNA

Evo 2 is the largest AI model for biology ever created, trained on an astonishing 9.3 trillion DNA "letters" (nucleotides) carefully selected from genomes spanning the entire tree of life. This massive dataset ensures that Evo 2 can recognize patterns and relationships in genetic sequences at an unparalleled scale.

For the first time, scientists can design DNA with AI, moving beyond simple sequence analysis to active DNA generation. Evo 2 enables researchers to predict, modify, and even create entire genetic sequences, opening new possibilities in medicine, agriculture, and synthetic biology.

Decoding the Dark Genome

One of the biggest challenges in genetics is understanding the non-coding regions of DNA—vast stretches of the genome that do not code for proteins but play crucial roles in regulating gene expression. These regions control when and how genes are activated, influencing everything from development to disease.

Evo 2 is designed to decode these non-coding elements, helping researchers uncover their functions and use this knowledge to develop gene-based therapies, synthetic life forms, and precision agriculture solutions.

From Reading DNA to Writing It

To put Evo 2’s impact into perspective:

• Previous AI models could "read" DNA like a book, analyzing genetic sequences and identifying patterns.
• Evo 2 can "write" entirely new DNA, designing functional genes, chromosomes, and even full genomes from scratch.

This means scientists can now engineer biological systems with AI, designing new proteins, metabolic pathways, and genetic circuits to address real-world challenges.

A Step Toward Generative Biology

The Arc Institute describes Evo 2 as a major step toward "generative biology"—a revolutionary approach where AI is used to create novel biological structures rather than just analyzing existing ones. This could lead to breakthroughs such as:

• New medicines: AI-generated enzymes and proteins tailored for targeted therapies.
• Disease-resistant crops: Genetically optimized plants for higher yield and climate resilience.
• Synthetic organisms: Custom-designed microbes for bioremediation, biofuel production, and industrial applications.

An Open-Source Revolution

Unlike many proprietary AI models, Evo 2 is open source, making its capabilities accessible to researchers worldwide. This democratization of AI-driven biology means that scientists from different disciplines can collaborate, experiment, and innovate, accelerating discoveries in genetic engineering and synthetic biology.

With Evo 2, the boundaries of what’s possible in DNA design, genetic engineering, and biological innovation are being redrawn. The future of life sciences is no longer just about understanding life’s code—it’s about writing it.

The new approach involves the use of cytomegalovirus, or CMV, a common virus already carried by a large percentage of the population. Dr Picker and his colleagues discovered that pairing CMV with SIV had a unique effect.

Research finding provide compelling evidence for progressive clearance of a pathogenic lentiviral infection, and suggest that some lentiviral reservoirs may be susceptible to the continuous effector memory T-cell-mediated immune surveillance elicited and maintained by cytomegalovirus vectors.

Reference:

http://www.nature.com/nature/journal/vaop/ncurrent/full/nature12519.html

http://www.bbc.co.uk/news/science-environment-24051860

Image Source: ucsf.edu

RNAs, especially non-coding RNAs (such as microRNA, long ncRNAs) are recently identified to be very abundant in mammalian organisms and play some key roles in gene expression regulation, gene silencing, and also implicated in disease progression, stem cell pluripotency etc. Current research activities of our lab include analysis of expression pattern of ncRNAs by microarray and next-gen sequencing data and understanding the role of miRNAs or other regulatory RNAs in various diseases, especially cancer and validation by reporter assays (renilla/luciferase) and other experimental tools.

More @ http://vvekslab.in/index.html

https://www.pmgenomics.ca/hoffmanlab/

CPAT - https://github.com/liguowang/cpat, http://lilab.research.bcm.edu/ (web server)

CPC2 - https://github.com/gao-lab/CPC2_standalone, http://cpc2.gao-lab.org/ (web server)

Infernal - http://eddylab.org/infernal/, https://github.com/EddyRivasLab/infernal

NCBI RefSeq - https://www.ncbi.nlm.nih.gov/refseq/

Rfam - http://rfam.xfam.org/, https://docs.rfam.org/en/latest/index.html

SILVA - https://www.arb-silva.de/

RNAmmer - http://www.cbs.dtu.dk/services/RNAmmer/ (web server, standalone download link)

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.