Address of the bookmark: https://github.com/hugheslab/snpgenie

Perl's second wave of adoption came from the growth of the world wide web. Dynamic web pages—the precursor to modern web applications—were easy to create with Perl and CGI. Thanks to Perl's ubiquity as a language for system administrators and its power to manipulate text, it was the default choice for web programming. Its presence everywhere made it popular and, in some ways, the duct tape of the Internet.

Web Application Development

The old days of CGI programs and the simple development style that represented seem clunky. Web pages have become web applications. Development has moved from generating static HTML to both client and server side programming, with rich client interfaces and powerful backends.

Perl is still well suited for developing modern web apps. The language grows more powerful and easier to use every year, the available libraries are wonderful and keep getting better, and the inventions and discoveries available in modern Perl are unsurpassed.

In particular, a modern Perl developer can do amazing things with modern Perl tools. If you still think of Perl web development as a cgi-bin directory full of messy scripts that spew warnings to STDERR, you're a decade out of date. Better yet, you can replace that mess piecemeal, thanks to the new tools and techniques of modern Perl. See, for example, the ever-growing list of technologies Built in Perl.

Modern Perl Web Frameworks

While the old wave of web development may have made the CGI.pm module central, modern Perl web programming follows a stricter separation of business logic, URL and request routing, and output. The days of slinging a string here, an array there, a Perl hash yonder, declaring every variable at the top of the program, and maybe making a subroutine are gone. The Perl world has seen the value of abstraction and ways to mechanize away boilerplate. Perl has dozens of frameworks and toolkits designed to make web development and deployment simpler.

Any of a dozen of these frameworks will help you do great things, but three in particular stand out. You can build web sites and web applications of tremendous value with all three. These are neither the only good possibilities (think of POE or Jifty or Continuity or...) nor the only mechanisms for web programming with Perl (see Mechanize or LWP or Mojo::UserAgent for more). Yet if you want three good options to choose between, start here.

Catalyst

The Catalyst framework is a flexible and powerful system for building small to large web apps. It uses the Moose object system to provide great APIs for extension and further development. It's the most mature of the modern top Perl web frameworks, yet it retains its flexibility and vibrancy. In particular, its plugin and extension ecosystem allows it to evolve to provide new and essential features.

Catalyst has embraced the Plack/PSGI standard for Perl web deployment and recent versions are exploring high-scalability, event-based request handling models.

Dancer

The Dancer framework is deliberately minimal in syntax and scope, but it also has a vibrant plugin ecosystem. Dancer particularly excels for smaller sites and applications, though good programmers can build larger things with it.

The first version of Dancer was easy to use. Dancer 2 continues that ease while improving the internals and robustness of applications.

Mojolicious

The Mojolicious (Mojo) framework has a real-time design based on high performance event handling. Its focus is solving new and interesting problems in simple and effective ways, and the project has produced a lot of new code that does old things in better ways.

In particular, Mojolicious goes to great lengths to support new web standards, such as CSS 3, web sockets, and HTTP 2.

Where Catalyst embraces the CPAN fully, Mojolicious by design provides most of what an average app might need in a single download. It's still fully compatible with the CPAN, but the intention is to provide good working defaults in a package that's easy to start with. Mojo's fans are quick to praise it as fun to develop.

A modern Perl web developer should be familiar with at least one of these frameworks.

Modern Perl Storage Mechanisms

Perl's venerable DBI module has been the focal point of database access since its invention. Its design allows it to provide the same interface to huge relational databases and flat files alike through its DBD extension mechanism. Yet the DBI by itself isn't the be-all, end-all of data storage and access in Perl.

DBIx::Class

DBIx::Class sits on top of DBI to provide an API to your database based on the concept of queries and results. This is often sufficient to remove all but the most complicated of SQL from your code, leaving you to manipulate your business models instead of the small details of how a relational database works. The power and maintainability you receive is well the small cost of the learning curve.

Even better, DBIC can manage (and even generate) your database schema for you.

Recent versions of DBIC have demonstrated that a well-written ORM can perform much better than even clever hand-written code. Because it builds on the Perl DBI, it scales everywhere from SQLite to PostgreSQL, MySQL, Oracle, and more.

Rose::DB

The lesser-known but no less powerful Rose::DB::Object builds on Rose::DB to provide an object-relational mapper for Perl. While its high level features most directly compare to those of DBIx::Class, it's often measurably faster.

NoSQL on the CPAN

Of course the CPAN has modules for almost any NoSQL database or job queue or persistence mechanism you could name, and several you have never heard of. Everything you need is a quick CPAN or cpanm away!

Modern Perl Deployment Strategies

In the early days of the web, deploying a Perl web application meant putting one or more .cgi or .pl files in a special directory and hoping that your system administrator had everything configured correctly. The execution model was often slow and cumbersome, and accessing shared resources such as databases was often tricky.

Modern Perl has better choices. While deployment strategies are the source of many arguments, the return on your investment from learning the modern way is impressive.

Plack/PSGI

The PSGI specification (as exemplified by Plack) describes a strategy for building Perl web apps independent of server and with the possibility to share custom processing behaviors.

In other words, it's a standard for writing Perl apps to take advantage of the huge ecosystem of Perl development available on the CPAN without tying yourself to a server like Apache, Apache 2, nginx, or anything else.

Any good modern Perl web framework (including those listed here) supports PSGI. Several deployment mechanisms exist to meet various business needs which also support PSGI. In particular, you can deploy the same application with a local testing server on your own machine as you can to your production server or servers without changing your application at all.

mod_perl

The older but still viable mod_perl Apache httpd module embeds Perl into the web server. This was the first widespread persistence mechanism for Perl web applications themselves and it's still popular to this day, though PSGI compliance is often the choice for new development. (PSGI handlers to use mod_perl as the backend are available.)

Modern Perl developers should familiarize themselves with PSGI and the wealth of available Plack middleware.

Perl Web Development

Of course no discussion of Perl web development would be complete without mentioning the strength of the CPAN. Almost any project will benefit from the wealth of freely available libraries built to solve real problems. These distributions run the gamut from full-blown web frameworks and content management systems to APIs for web services, development tools, testing systems, and interfaces to document formats and external resources.

For example, if you need to write a web service which accepts JSON data and produces Excel spreadsheets, you can glue together a few CPAN distributions and get the job done early. If you need to consume XML from a remote service and emit a PDF, you're in luck.

Perl's prowess as a general purpose programming language as well as its flexibility and power in managing text and gluing systems together make it a wonderful fit for web development. The community's adoption of modern Perl standards such as PSGI and Plack only enhance your power.

Web application development in Perl is still viable, and modern Perl tools and techniques and libraries make it more powerful and pleasant than ever.

Read more: https://edu.t-bio.info/amity-university-summer-bioinformatics-program-registrations-are-open/

Can't locate XML/parser.pm in @INC (@INC contains:
/usr/lib/perl5/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/5.10.0
/usr/local/lib/perl5/site_perl/5.10.0/i386-linux-thread-multi
/usr/local/lib/perl5/site_perl/5.10.0
/usr/lib/perl5/vendor_perl/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.10.0 /usr/lib/perl5/vendor_perl
/usr/lib/perl5/site_perl/5.10.0 .)

Manual Method of Perl Module Installation

• Install Perl Modules Manually

This manual method is very useful when your computer or server is not connected to the Internet.

Download Perl module:
Go to CPAN Search website and search for the module that you wish to download. In this example, let us search, download and install XML::Parser Perl module. I have downloaded the XML-Parser-2.36.tar.gz to /home/download

# cd /home/download
# gzip -d XML-Parser-2.36.tar.gz
# tar xvf XML-Parser-2.36.tar
# cd XML-Parser-2.36

Build the perl module:
Build by running Makefile.PL, remember the case sensitivity, make and make test.

# perl Makefile.PL
Checking if your kit is complete...
Looks good
Writing Makefile for XML::Parser::Expat
Writing Makefile for XML::Parser
# make
# make test

Install the perl module:
Now your package is ready to install.

# make install

As a newbie it looks pretty simple, and one go. But, luckily this is a very simple one module with no dependencies. Typically, Perl modules will be dependent on several other modules. Just imagine chasing all these dependencies one-by-one, thinking ... oh ye I got it. That will be very painful and annoying task. I recommend the CPAN method of installation as shown below.

Install Perl Modules using CPAN automatically

Logically, you should must have the CPAN perl module installed in your server or computer before you can install any other Perl modules using CPAN. I know you  are laughing, "to install a perl module you need another perl module"  ;)

Lets verify whether CPAN is already installed:

To install Perl modules using CPAN, make sure the cpan command is working. Following are the error message when CPAN module is not installed.

# cpan
-bash: cpan: command not found

# perl -MCPAN -e shell
Can't locate CPAN.pm in @INC (@INC contains:
/usr/lib/perl5/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/5.10.0
/usr/local/lib/perl5/site_perl/5.10.0/i386-linux-thread-multi
/usr/local/lib/perl5/site_perl/5.10.0
/usr/lib/perl5/vendor_perl/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.10.0
/usr/lib/perl5/vendor_perl /usr/lib/perl5/site_perl/5.10.0 .).
BEGIN failed--compilation aborted.

Install the CPAN module using yum:
If CPAN in not installed in your system, you can use "yum" for the rescue. Dont worry biological data cruncher, this is true we are now dependent all these tiny magicians :).

# yum install perl-CPAN

Output of yum install perl-CPAN command:

Loaded plugins: refresh-packagekit
updates-newkey                       | 2.3 kB     00:00
primary.sqlite.bz2                   | 2.4 MB     00:00
Setting up Install Process
Parsing package install arguments

Resolving Dependencies
Transaction Summary
=============================================================================
Install      5 Package(s)
Update       0 Package(s)
Remove       0 Package(s)

Total download size: 1.0 M
Is this ok [y/N]: y
Downloading Packages:
(1/5): perl-ExtUtils-ParseXS-2.18-31.fc9.i386.rpm     |  30 kB     00:00
(2/5): perl-Test-Harness-2.64-31.fc9.i386.rpm         |  70 kB     00:00
(3/5): perl-CPAN-1.9205-31.fc9.i386.rpm               | 217 kB     00:00
(4/5): perl-ExtUtils-MakeMaker-6.36-31.fc9.i386.rpm   | 284 kB     00:00
(5/5): perl-devel-5.10.0-31.fc9.i386.rpm              | 408 kB     00:00

Installing     : perl-ExtUtils-ParseXS                             [1/5]
Installing     : perl-devel                                        [2/5]
Installing     : perl-Test-Harness                                 [3/5]
Installing     : perl-ExtUtils-MakeMaker                           [4/5]
Installing     : perl-CPAN                                         [5/5]


Installed: perl-CPAN.i386 0:1.9205-31.fc9
Dependency Installed:
  perl-ExtUtils-MakeMaker.i386 0:6.36-31.fc9
  perl-ExtUtils-ParseXS.i386 1:2.18-31.fc9
  perl-Test-Harness.i386 0:2.64-31.fc9
  perl-devel.i386 4:5.10.0-31.fc9
Complete!

Configure cpan the first time:
Once the CPAN is installed, you need to configure it by executing cpan, you should set some configuration parameters as shown below. I have shown only the important configuration parameters below. Accept all the default values by pressing enter.

Note: Make sure to execute “o conf commit” in the cpan prompt after the configuration to save the settings.

# cpan

Sorry, we have to rerun the configuration dialog for CPAN.pm due
to some missing parameters...

CPAN build and cache directory? [/root/.cpan]
Download target directory? [/root/.cpan/sources]
Directory where the build process takes place? [/root/.cpan/build]

Always commit changes to config variables to disk? [no]
Cache size for build directory (in MB)? [100]
Let the index expire after how many days? [1]

Perform cache scanning (atstart or never)? [atstart]
Cache metadata (yes/no)? [yes]
Policy on building prerequisites (follow, ask or ignore)? [ask]

Parameters for the 'perl Makefile.PL' command? []
Parameters for the 'perl Build.PL' command? []

Your ftp_proxy? []
Your http_proxy? []
Your no_proxy? []
Is it OK to try to connect to the Internet? [yes]

First, pick a nearby continent and country by typing in the number(s)
(1) Africa
(2) Asia
(3) Central America
(4) Europe
(5) North America
(6) Oceania
(7) South America
Select your continent (or several nearby continents) [] 5

(1) Bahamas
(2) Canada
(3) Mexico
(4) United States
Select your country (or several nearby countries) [] 4

(2) ftp://carroll.cac.psu.edu/pub/CPAN/
(3) ftp://cpan-du.viaverio.com/pub/CPAN/
(4) ftp://cpan-sj.viaverio.com/pub/CPAN/
(5) ftp://cpan.calvin.edu/pub/CPAN
(6) ftp://cpan.cs.utah.edu/pub/CPAN/
e.g. '1 4 5' or '7 1-4 8' [] 2-16

cpan[1]> o conf commit
commit: wrote '/usr/lib/perl5/5.10.0/CPAN/Config.pm'

cpan[2]> quit
No history written (no histfile specified).
Lockfile removed.

• Install Perl Modules using CPAN

Hey smile please, now you are ready with CPAN and can download modules in one line command.

You can use one of the following method to install a Perl module using cpan:

# perl -MCPAN -e 'install Bundle::BioPerl'

(or)

# cpan
cpan shell -- CPAN exploration and modules installation (v1.9205)
ReadLine support available (maybe install Bundle::CPAN or Bundle::CPANxxl?)

cpan[1]> install "Bundle::BioPerl"

In the example above, CPAN will check for Bundle::BioPerl dependencies and automatically resolves and installs Bundle::BioPerl with all the dependent Perl modules.

• Quick Ways

Oh, look at your face.. smily hmm :). This is what your are looking for, a quick and best way to install Perl modules, Bioperl. Following are the the steps to download BioPerl in your server/computer.

# sudo apt-cache search perl BioPerl

Output will be like as follows:

bioperl - Perl tools for computational molecular biology
bioperl-run - BioPerl wrappers: scripts
libbio-perl-perl - BioPerl core perl modules
libbio-perl-run-perl - BioPerl wrappers: modules
libbio-samtools-perl - Perl interface to SamTools library for DNA sequencing
libbiojava-java - Java API to biological data and applications (default version)
libbiojava3-java - Java API to biological data and applications (default version)
python-biopython-sql - Biopython support for the BioSQL database schema
libbtlib-perl - library for basic sequence manipulation

# sudo apt-get install bioperl

If it is installed then flash the following message:

Reading package lists... Done
Building dependency tree      
Reading state information... Done
bioperl is already the newest version.
0 upgraded, 0 newly installed, 0 to remove and 10 not upgraded.

In it is found not installed in your server or system them install all with dependencies.

You can use the same approach to install all the modules, and packages if required.

Thanks for reading. Best of luck for your research.

• updated composition-based statistics for protein-protein (including translated BLAST) comparisons to provide stable results when you request fewer than the default number of results
• an experimental Adaptive Composition Based Statistics option that increases the likelihood of finding novel results.  To enable this option set the environment variable ADAPTIVE_CBS to 1.  We welcome your feedback on this new option.

See the release notes for details on more  improvements and bug fixes with this release.

BLAST+ is also available in docker, please read more for details.

The new version fully supports the version 5 (v5) databases with built in taxonomy and other improvements. For more information on v5 databases (download), see the previous NCBI Insights article and the recording of our webinar.  If you are still using the older version 4 (v4) databases, we recommend you begin using the v5 version as soon as possible.  We will discontinue updates to the older v4 databases in early 2020.

BLAST+ Team

Many of the Perl scripts require that the VCF files are compressed by bgzip and indexed by tabix (both tools are part of the tabix package, available for download here). The VCF files can be compressed and indexed using the following commands

bgzip my_file.vcf
tabix -p vcf my_file.vcf.gz

http://vcftools.sourceforge.net/perl_module.html

Address of the bookmark: http://vcftools.sourceforge.net/perl_module.html

For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.

http://milkweedgenome.org/?q=scripts

Address of the bookmark: http://milkweedgenome.org/?q=scripts

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl