Can't locate XML/parser.pm in @INC (@INC contains:
/usr/lib/perl5/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/5.10.0
/usr/local/lib/perl5/site_perl/5.10.0/i386-linux-thread-multi
/usr/local/lib/perl5/site_perl/5.10.0
/usr/lib/perl5/vendor_perl/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.10.0 /usr/lib/perl5/vendor_perl
/usr/lib/perl5/site_perl/5.10.0 .)

Manual Method of Perl Module Installation

• Install Perl Modules Manually

This manual method is very useful when your computer or server is not connected to the Internet.

Download Perl module:
Go to CPAN Search website and search for the module that you wish to download. In this example, let us search, download and install XML::Parser Perl module. I have downloaded the XML-Parser-2.36.tar.gz to /home/download

# cd /home/download
# gzip -d XML-Parser-2.36.tar.gz
# tar xvf XML-Parser-2.36.tar
# cd XML-Parser-2.36

Build the perl module:
Build by running Makefile.PL, remember the case sensitivity, make and make test.

# perl Makefile.PL
Checking if your kit is complete...
Looks good
Writing Makefile for XML::Parser::Expat
Writing Makefile for XML::Parser
# make
# make test

Install the perl module:
Now your package is ready to install.

# make install

As a newbie it looks pretty simple, and one go. But, luckily this is a very simple one module with no dependencies. Typically, Perl modules will be dependent on several other modules. Just imagine chasing all these dependencies one-by-one, thinking ... oh ye I got it. That will be very painful and annoying task. I recommend the CPAN method of installation as shown below.

Install Perl Modules using CPAN automatically

Logically, you should must have the CPAN perl module installed in your server or computer before you can install any other Perl modules using CPAN. I know you  are laughing, "to install a perl module you need another perl module"  ;)

Lets verify whether CPAN is already installed:

To install Perl modules using CPAN, make sure the cpan command is working. Following are the error message when CPAN module is not installed.

# cpan
-bash: cpan: command not found

# perl -MCPAN -e shell
Can't locate CPAN.pm in @INC (@INC contains:
/usr/lib/perl5/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/5.10.0
/usr/local/lib/perl5/site_perl/5.10.0/i386-linux-thread-multi
/usr/local/lib/perl5/site_perl/5.10.0
/usr/lib/perl5/vendor_perl/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.10.0
/usr/lib/perl5/vendor_perl /usr/lib/perl5/site_perl/5.10.0 .).
BEGIN failed--compilation aborted.

Install the CPAN module using yum:
If CPAN in not installed in your system, you can use "yum" for the rescue. Dont worry biological data cruncher, this is true we are now dependent all these tiny magicians :).

# yum install perl-CPAN

Output of yum install perl-CPAN command:

Loaded plugins: refresh-packagekit
updates-newkey                       | 2.3 kB     00:00
primary.sqlite.bz2                   | 2.4 MB     00:00
Setting up Install Process
Parsing package install arguments

Resolving Dependencies
Transaction Summary
=============================================================================
Install      5 Package(s)
Update       0 Package(s)
Remove       0 Package(s)

Total download size: 1.0 M
Is this ok [y/N]: y
Downloading Packages:
(1/5): perl-ExtUtils-ParseXS-2.18-31.fc9.i386.rpm     |  30 kB     00:00
(2/5): perl-Test-Harness-2.64-31.fc9.i386.rpm         |  70 kB     00:00
(3/5): perl-CPAN-1.9205-31.fc9.i386.rpm               | 217 kB     00:00
(4/5): perl-ExtUtils-MakeMaker-6.36-31.fc9.i386.rpm   | 284 kB     00:00
(5/5): perl-devel-5.10.0-31.fc9.i386.rpm              | 408 kB     00:00

Installing     : perl-ExtUtils-ParseXS                             [1/5]
Installing     : perl-devel                                        [2/5]
Installing     : perl-Test-Harness                                 [3/5]
Installing     : perl-ExtUtils-MakeMaker                           [4/5]
Installing     : perl-CPAN                                         [5/5]


Installed: perl-CPAN.i386 0:1.9205-31.fc9
Dependency Installed:
  perl-ExtUtils-MakeMaker.i386 0:6.36-31.fc9
  perl-ExtUtils-ParseXS.i386 1:2.18-31.fc9
  perl-Test-Harness.i386 0:2.64-31.fc9
  perl-devel.i386 4:5.10.0-31.fc9
Complete!

Configure cpan the first time:
Once the CPAN is installed, you need to configure it by executing cpan, you should set some configuration parameters as shown below. I have shown only the important configuration parameters below. Accept all the default values by pressing enter.

Note: Make sure to execute “o conf commit” in the cpan prompt after the configuration to save the settings.

# cpan

Sorry, we have to rerun the configuration dialog for CPAN.pm due
to some missing parameters...

CPAN build and cache directory? [/root/.cpan]
Download target directory? [/root/.cpan/sources]
Directory where the build process takes place? [/root/.cpan/build]

Always commit changes to config variables to disk? [no]
Cache size for build directory (in MB)? [100]
Let the index expire after how many days? [1]

Perform cache scanning (atstart or never)? [atstart]
Cache metadata (yes/no)? [yes]
Policy on building prerequisites (follow, ask or ignore)? [ask]

Parameters for the 'perl Makefile.PL' command? []
Parameters for the 'perl Build.PL' command? []

Your ftp_proxy? []
Your http_proxy? []
Your no_proxy? []
Is it OK to try to connect to the Internet? [yes]

First, pick a nearby continent and country by typing in the number(s)
(1) Africa
(2) Asia
(3) Central America
(4) Europe
(5) North America
(6) Oceania
(7) South America
Select your continent (or several nearby continents) [] 5

(1) Bahamas
(2) Canada
(3) Mexico
(4) United States
Select your country (or several nearby countries) [] 4

(2) ftp://carroll.cac.psu.edu/pub/CPAN/
(3) ftp://cpan-du.viaverio.com/pub/CPAN/
(4) ftp://cpan-sj.viaverio.com/pub/CPAN/
(5) ftp://cpan.calvin.edu/pub/CPAN
(6) ftp://cpan.cs.utah.edu/pub/CPAN/
e.g. '1 4 5' or '7 1-4 8' [] 2-16

cpan[1]> o conf commit
commit: wrote '/usr/lib/perl5/5.10.0/CPAN/Config.pm'

cpan[2]> quit
No history written (no histfile specified).
Lockfile removed.

• Install Perl Modules using CPAN

Hey smile please, now you are ready with CPAN and can download modules in one line command.

You can use one of the following method to install a Perl module using cpan:

# perl -MCPAN -e 'install Bundle::BioPerl'

(or)

# cpan
cpan shell -- CPAN exploration and modules installation (v1.9205)
ReadLine support available (maybe install Bundle::CPAN or Bundle::CPANxxl?)

cpan[1]> install "Bundle::BioPerl"

In the example above, CPAN will check for Bundle::BioPerl dependencies and automatically resolves and installs Bundle::BioPerl with all the dependent Perl modules.

• Quick Ways

Oh, look at your face.. smily hmm :). This is what your are looking for, a quick and best way to install Perl modules, Bioperl. Following are the the steps to download BioPerl in your server/computer.

# sudo apt-cache search perl BioPerl

Output will be like as follows:

bioperl - Perl tools for computational molecular biology
bioperl-run - BioPerl wrappers: scripts
libbio-perl-perl - BioPerl core perl modules
libbio-perl-run-perl - BioPerl wrappers: modules
libbio-samtools-perl - Perl interface to SamTools library for DNA sequencing
libbiojava-java - Java API to biological data and applications (default version)
libbiojava3-java - Java API to biological data and applications (default version)
python-biopython-sql - Biopython support for the BioSQL database schema
libbtlib-perl - library for basic sequence manipulation

# sudo apt-get install bioperl

If it is installed then flash the following message:

Reading package lists... Done
Building dependency tree      
Reading state information... Done
bioperl is already the newest version.
0 upgraded, 0 newly installed, 0 to remove and 10 not upgraded.

In it is found not installed in your server or system them install all with dependencies.

You can use the same approach to install all the modules, and packages if required.

Thanks for reading. Best of luck for your research.

• updated composition-based statistics for protein-protein (including translated BLAST) comparisons to provide stable results when you request fewer than the default number of results
• an experimental Adaptive Composition Based Statistics option that increases the likelihood of finding novel results.  To enable this option set the environment variable ADAPTIVE_CBS to 1.  We welcome your feedback on this new option.

See the release notes for details on more  improvements and bug fixes with this release.

BLAST+ is also available in docker, please read more for details.

The new version fully supports the version 5 (v5) databases with built in taxonomy and other improvements. For more information on v5 databases (download), see the previous NCBI Insights article and the recording of our webinar.  If you are still using the older version 4 (v4) databases, we recommend you begin using the v5 version as soon as possible.  We will discontinue updates to the older v4 databases in early 2020.

BLAST+ Team

Many of the Perl scripts require that the VCF files are compressed by bgzip and indexed by tabix (both tools are part of the tabix package, available for download here). The VCF files can be compressed and indexed using the following commands

bgzip my_file.vcf
tabix -p vcf my_file.vcf.gz

http://vcftools.sourceforge.net/perl_module.html

Address of the bookmark: http://vcftools.sourceforge.net/perl_module.html

For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.

http://milkweedgenome.org/?q=scripts

Address of the bookmark: http://milkweedgenome.org/?q=scripts

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.

Responsibilities:Design efficient SQL queries for pulling large sequencing projects.
Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.
Develop and oversee a rapid and incremental software development and release schedule.
Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.
Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.
Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.
Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.
Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.
Assist in training of breeders in the CGIAR centers to use software developed.
Personal Profile:

The applicant should have:

Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL
High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.
She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.
Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.
Ability to mentor colleagues in quality software development practices is desired.
Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.

More at http://www.icrisat.org/careers/

If you have any questions or comments, post them on one of the trackers on BRIG’s SourceForge page:http://sourceforge.net/tracker/?group_id=328245.

Features:

• Images show similarity between a central reference sequence and other sequences as concentric rings.
• BRIG will perform all BLAST comparisons and file parsing automatically via a simple GUI.
• Contig boundaries and read coverage can be displayed for draft genomes; customized graphs and annotations can be displayed.
• Using a user-defined set of genes as input, BRIG can display gene presence, absence, truncation or sequence variation in a set of complete genomes, draft genomes or even raw, unassembled sequence data.
• BRIG also accepts SAM-formatted read-mapping files enabling genomic regions present in unassembled sequence data from multiple samples to be compared simultaneously

Address of the bookmark: http://brig.sourceforge.net/

1. Learn and get updated

Some of the bad biological programmers only learn new technical or non-technical things when it’s absolutely necessary. The good biological programmers learn new technical skills proactively. But great biological programmers not only learn new technical skills on their own but also learn non-technical skills, and have an open mind to sources of knowledge that others may shut out.

In other concrete term, the bad biological programmer learn Perl's regular expression when they started a project on comparative genomics; the good biological programmer learned it a year before because it looked interesting; and the great biological programmer also read about the BioPerl packages, genomics, DNA string, genomic theories, or some similar course of study so that they could understand the results and explain it biologically.

2. Not a merely coder!!!

I often encountered with biological programmer who call themself a hard-core computer programmer and avoid biology. I can almost guarantee that if you are one of them then you are not doing research but merely writing "dry" codes.

According to my supervisor most of the computational biologist, don't know what they are doing biologically. Even they struggle to explain their own programs output and results. Therefore, It is highly advisable to learn basic of biology which can assist you to explain the result and understand your discovery. Always remember you are a researcher not a coder.

3. Be Social with biologist

The computational biologist spends most of the time in from of computers, writing codes. They always think their job is to produce working codes, not technical research perfections. But, they are completely wrong. You should not forget that apart from your computational skills you also need some biologist, other than your supervisor, to explain and make you understand the complex biological mechanism.

I highly recommend your to interact with biotech researchers and learn how do they explain their one graph (which they generally produce after one year of work) biologically. Remember, the origin of your research project is complex biological phenomenon, which is more complex than that of your limited programming rules.

4. Do not search, research for answers

Researching for answers means more than typing several keywords into a search engine or posting a question at Stack Overflow or the BioStars forums. I have entered problems into search engines that generate no results, and every question I posted on Stack Overflow or the BioStars forums never got anything resembling an answer, yet I solved the issues and moved on. I’m not a magician — I just know how to find answers or discover root causes.

Many problems are situational, and if you depend on search engines and forums, you can waste a lot of time going down a rabbit hole and possibly never getting a solution. Learn to perform root cause analysis, learn enough about the underlying system to look for other clues and solutions, and learn to take a long distance view of an issue before deep diving into it.

5. Love and defend your research

You cannot rise to the top in this research profession without loving your work. There are some very good “it’s just a job” biological programmers (I’ve been one at times), but if that is your outlook, you won’t be willing to do whatever it takes to succeed. This idea gets a lot of folks in a huff, because they feel it is a personal insult. “I’m a good programmer, but I have other priorities and can’t make work my life.” I understand completely; I have other priorities too. As much as I hate to say it, when I am passionate about my work, I am willing (though not eager) to abandon my other priorities to finish the job. It is not an insult to say that if you aren’t willing to pull out all the stops you can’t be the best, it is a fact.

You must be passionate about more than programming — you must also be excited about your research, the tools and technology you are using, and so on. I have seen very good and even great biological programmers operating at mediocre levels because something was not a good fit, such as they hated the project or were using a technology they disliked. Therefore, like your research project and get excited about your discoveries. You have not only to discover but also defend your finding with scientific words.

Thanks to all of you for reading.