<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/4193?offset=340</link>
	<atom:link href="https://bioinformaticsonline.com/related/4193?offset=340" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12566/jrf-at-national-research-centre-on-plant-biotechnology</guid>
  <pubDate>Fri, 04 Jul 2014 13:36:02 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF at NATIONAL RESEARCH CENTRE ON PLANT BIOTECHNOLOGY]]></title>
  <description><![CDATA[
<p>NATIONAL RESEARCH CENTRE ON PLANT BIOTECHNOLOGY</p>

<p>New Delhi-110012</p>

<p>Walk in interview</p>

<p>Eligible candidates may appear for Walk-in interview for the temporary positions of JRF/SRF/ RA, in ICAR, DBT funded research projects. Positions are purely temporary in nature and are co-terminus with the projects. The initial appointment will be for maximum one year, which can be extended on the basis of assessment of the candidate performance and need in the project work (PI-Dr. N. K. Singh, National Professor).</p>

<p>Name of the</p>

<p>PI (Project)<br />	</p>

<p>Name of</p>

<p>Position<br />	</p>

<p>Number of</p>

<p>positions<br />	</p>

<p>Emoluments</p>

<p>Fixed per</p>

<p>month (Rs.)<br />	</p>

<p>Essential</p>

<p>Qualifications</p>

<p>DBT-“Physical Mapping and Sample sequencing of Wheat Chromosome 2A- International Wheat Genome Sequencing Consortium (India)”.</p>

<p>(Up to Nov,2014)</p>

<p>DBT- Identification and functional analysis of genes related to yield and biotic stresses (Up to Oct,2014)</p>

<p>NPTC-Central Facility<br />	</p>

<p>RA (Master)</p>

<p>JRF/SRF</p>

<p>Research Associate: One</p>

<p>Essential: MCA or M. Tech. (Bioinformatics and computer Science with 2 years experience in Database Management with</p>

<p>MySQL, Linux)</p>

<p>Desirable: Proficiency in handling of large biological databases</p>

<p>Age limit: Max. Age 35 years (Age of relaxation of 5 years for SC/ST&amp; woman. and 3 years for OBC). The interview will be held on 08 July, 2014 at 11 am at room no. 39, NRCPB, LBS Building, Pusa Campus, New Delhi-110012. The candidates must bring original certificates and four copies of biodata, and recent passport size photograph. No TA/DA would be given for the appearance in interview. Only the candidates having essential qualifications would be entertained for the interviews.</p>

<p>Advertisement:</p>

<p>www.nrcpb.org/sites/default/files/news%20paper%20advirtisment..docx</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/4882/detect-the-sequence-pattern-and-its-location-in-fasta-file-with-match-and-mismatches-information</guid>
	<pubDate>Thu, 26 Sep 2013 15:02:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/4882/detect-the-sequence-pattern-and-its-location-in-fasta-file-with-match-and-mismatches-information</link>
	<title><![CDATA[Detect the sequence pattern and its location in fasta file with match and mismatches information.]]></title>
	<description><![CDATA[<p>This script is one of my old script to detect some centromeric pattern in chromosomes. User can also control the number of mismatches allowed through command line ..</p><p>To run:</p><p>perl centro.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/4882" length="3596" type="text/x-perl" />
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12988/guest-lecturer-molecular-biology-bioinformatics</guid>
  <pubDate>Wed, 23 Jul 2014 13:34:41 -0500</pubDate>
  <link></link>
  <title><![CDATA[Guest Lecturer - Molecular Biology &amp; Bioinformatics]]></title>
  <description><![CDATA[
<p>Adv. No. F.TU/ACA/GT-APP/01/14 Date: 07.07.2014</p>

<p>Faculty of Science</p>

<p>Essential Qualifications:</p>

<p>(i) Good academic record having at least 55% marks (or an equivalent grade in a point scale wherever grading system is followed) at the Master’s Degree level in a relevant subject, from an Indian University, or an equivalent degree from an accredited foreign University.</p>

<p>(II) Besides fulfilling the above qualifications, the candidates must have cleared the National Eligibility Test (NET) conducted by the UGC, CSIR or similar test accredited by the UGC like SLET/SET.</p>

<p>(III) Notwithstanding anything contained in sub-clauses (i) and (ii) of clause 4.4.1 of UGC regulations 2010, candidates, who are, or have been awarded a Ph.D. Degree in accordance with the University Grants Commission (Minimum Standards and Procedure for Award of Ph.D. Degree) Regulations, 2009, shall be exempted from the requirement of the minimum eligibility condition of NET/ SLET/ SET for engagement of guest Teacher.</p>

<p>(IV) NET/ SLET/ SET shall also not be required for such Master’s Degree Programmes in discipline for which NET/ SLET/ SET is not conducted.</p>

<p>Application form along with detailed instructions can be downloaded from Tripura University website: www.tripurauniv.in. The duly filled in application forms complete in all respects may be sent so as to reach the Office of the Deputy Registrar Academic Branch, Tripura University, Suryamaninagar - 799022, Tripura on or before 31st July, 2014. The Candidates who responded against advertisement No. TU.REG/N-Advt./02/10 dated 20.02.2014 need not apply again.</p>

<p>For more info visit: http://www.tripurauniv.in/images/universitymedia/EmploymentNotification/Guest%20Teacher%20Advt.%20website_09072014.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33689/bio-graphics-237</guid>
	<pubDate>Sun, 25 Jun 2017 17:52:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33689/bio-graphics-237</link>
	<title><![CDATA[Bio-Graphics-2.37]]></title>
	<description><![CDATA[<p>BioPerl modules&nbsp;<a href="http://search.cpan.org/~lds/Bio-Graphics-2.37/lib/Bio/Graphics.pm">Bio::Graphics</a>&nbsp;+&nbsp;<a href="http://search.cpan.org/~cjfields/BioPerl-1.6.923/Bio/DB/GFF.pm">Bio::DB:GFF</a>&nbsp;and example scripts. It can draw some of the (but not all) feature types GBrowse can draw. This script should contain everything you can probably make use of (e.g. transcripts, segments, etc.) and you can try to find a good way of visualization by experimenting with its options.</p>
<p>http://search.cpan.org/~lds/Bio-Graphics-2.37/</p><p>Address of the bookmark: <a href="http://search.cpan.org/~lds/Bio-Graphics-2.37/" rel="nofollow">http://search.cpan.org/~lds/Bio-Graphics-2.37/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/14215/the-8000-years-old-tibetian-gene-mutation</guid>
	<pubDate>Wed, 20 Aug 2014 21:57:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/14215/the-8000-years-old-tibetian-gene-mutation</link>
	<title><![CDATA[The 8000 years old Tibetian gene mutation !!!]]></title>
	<description><![CDATA[<p>A new study has provided insight into how gene mutation around 8,000 years ago helped Tibetans' to survive in the thin air on the Tibetan Plateau, where an average elevation is of 14,800 feet.<br /><br />A study led by University of Utah scientists is the first to find a genetic cause for the adaptation, a single DNA base pair change that dates back 8,000 years and demonstrate how it contributes to the Tibetans' ability to live in low oxygen conditions.</p><p>About 8,000 years ago, the gene EGLN1 changed by a single DNA base pair. Today, a relatively short time later on the scale of human history, 88 percent of Tibetans have the genetic variation, and it was virtually absent from closely related lowland Asians. The findings indicate the genetic variation endows its carriers with an advantage.<br /><br />In those without the adaptation, low oxygen caused their blood to become thick with oxygen-carrying red blood cells, an attempt to feed starved tissues, which could cause long-term complications such as heart failure. The researchers found that the newly identified genetic variation protected Tibetans by decreasing the over-response to low oxygen.</p><p>Reference: http://www.nature.com/nature/journal/v512/n7513/abs/nature13408.html</p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</guid>
	<pubDate>Mon, 08 Jan 2018 22:32:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</link>
	<title><![CDATA[Frontend: Perl Web framework documentation - Andrej Sali Lab]]></title>
	<description><![CDATA[<p><span>The frontend is a set of Perl classes that displays the web interface, allowing a user to upload their input files, start a job, display a list of all jobs in the system, and get back job results. The main&nbsp;</span><a href="https://saliweb.readthedocs.io/en/latest/modules/frontend.html#saliwebfrontend" title="saliwebfrontend"><code><span>saliwebfrontend</span></code></a><span>&nbsp;class must be subclassed for each web service. This class is then used to display the web pages using a set of CGI scripts that are set up automatically by the build system.</span></p><p>Address of the bookmark: <a href="https://saliweb.readthedocs.io/en/latest/frontend.html" rel="nofollow">https://saliweb.readthedocs.io/en/latest/frontend.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12936/assistant-professor-medical-bioinformatics</guid>
  <pubDate>Wed, 23 Jul 2014 05:00:38 -0500</pubDate>
  <link></link>
  <title><![CDATA[Assistant Professor - Medical Bioinformatics]]></title>
  <description><![CDATA[
<p>Advt. No : ME-I/A-IV/03/14</p>

<p>No.of Posts:01 (SC)</p>

<p>Pay Scale:</p>

<p>Pay Band of Rs.15600-39100 + Rs.6000/- GP +NPA @ 25% of Basic Pay +Learning Resource Allowance @ Rs.20,000/-P.A.+ Conveyance Allowance @ Rs. 1650/-P.M.+ Academic Allowance @ Rs.2500/- P.M. and other admissible allowances.</p>

<p>Qualifications:</p>

<p>Area of Specialization:-</p>

<p>Bioinformatics/Computational/Biology/Genomics/ Proteomics/ Structural Biology</p>

<p>1. Postgraduate qualification, e.g. Master’s Degree in Biotechnology/Bioinformatics/ Biophysics.</p>

<p>2. A Doctorate Degree of recognized University/Institute in a basic or allied Medical Science subject e.g. Medical Biotechnology/Biophysics. Bioinformatics/X-ray Crystallography/</p>

<p>Immunology/Structural Biology etc</p>

<p>Experience:</p>

<p>1.Minimum three years teaching and/or research experience in a recognized medical/research Institution in an allied medical subject after obtaining doctorate degree and preferably in Medical</p>

<p>Molecular Biology/ Biophysics/Structural Biology/Genomics and Clinical Proteomics/Computational Biology.</p>

<p>2. Minimum two publication with atleast one in international journal and atleast one as first author</p>

<p>Desirable:-</p>

<p>Consistently excellent scholastic/academic record, demonstrated ability to write grant proposal/(s) successfully, Post Doctoral training in a frontier area of medical Bioinformatics Research and of direct relevance to clinical diagnosis or patient care (preferably from a recognized top-ranking medical institution abroad)</p>

<p>Send your applications to O/O, Deputy Registrar, Recruitment &amp; Establishment Cell, University of Health Sciences, Rohtak by 08.7.2014</p>

<p>For more details,please visit website:http://pgimsrohtak.nic.in/2014%20AP%20Advt.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/13025/the-5-reasons-to-mistakes-at-bioinformatics-work</guid>
	<pubDate>Thu, 24 Jul 2014 02:51:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/13025/the-5-reasons-to-mistakes-at-bioinformatics-work</link>
	<title><![CDATA[The 5 reasons to mistakes at bioinformatics work !!!]]></title>
	<description><![CDATA[<p>When you're just starting out with biological programming, it's easy to run into complex problems that make you wonder how anyone has ever managed to write a program. There are some problems that trip up nearly every bioinformatician--everything from getting started understanding the biological problems to dealing with program design. Some random mistakes are so prominent that even experienced biological programmers do it. The 8 years in bioinformatics and my few random observations, most of them are snarky. These reasons will always take longer than expected and compel you to postpone your project deadline.</p><p><strong>1.Stupid for biologist:</strong> Biology is so complex that it will make bioinformatician feel stupid. There are no any universal fixed rules; it can surprise you any time. So be nice to biologists who ask questions and resolve your biological puzzles. Sometime you will have no idea what the hell you were doing either.<br /><br /><strong>2.Puzzling why:</strong> Do not hesitate to ask question. Especially. at the beginning of project you will have to ask a lot of questions. Instead of puzzling it out at end check out and clear your doubt even for a single error. It may can leads to wrong conclusion.<br /><br /><strong>3.Running marathon:</strong> The most of the biological software&rsquo;s documentation is always incomplete. In other word they are no more than 95 percent complete. Sometime a single problem can halt your entire project for months. Compilation and running the pipelines in tedious because almost all are interdependent and need proper configuration. I face the same kind of problem with Evolver :( &hellip; <br /><br /><strong>4.Folders missing:</strong> The pipelines generate lots of data, and we keep them in several folders for future use. But sometime we delete them by mistake and move to recovery&hellip;<br /><br /><strong>5.Digging deeper:</strong> Digging deeper is fruitful, but some time it can be catastrophic. You may get frustrated or direction less. So keep a biologist with you for rescue &hellip;. Sometime an expert computer programmer to handle your server. Remember, the server will always go down when you need it the most.<br /><br />The most common frustrating&nbsp; common line: Why do we do this again?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40724/the-raku-programming-language</guid>
	<pubDate>Tue, 28 Jan 2020 05:37:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40724/the-raku-programming-language</link>
	<title><![CDATA[The Raku Programming Language]]></title>
	<description><![CDATA[<p><span>Raku is a member of the Perl family of programming languages. Formerly known as Perl 6, it was renamed in October 2019. Raku introduces elements of many modern and historical languages. Compatibility with Perl was not a goal, though a compatibility mode is part of the specification.</span><span>&nbsp;</span></p>
<p><span>More at&nbsp;<a href="https://www.raku.org/">https://www.raku.org/</a></span></p><p>Address of the bookmark: <a href="https://www.raku.org/" rel="nofollow">https://www.raku.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>