This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

Currently, BETSY consists of modules required for the microarray and next-generation sequencing data [4] such as expression analysis, classification, peak calling, and visualization.

Address of the bookmark: https://github.com/jefftc/changlab

Interested applicants must submit CV and addresses of three references to ataulfo@unam.mx.

Tenure Track position in Genomic Sciences

Laboratorio Internacional de Investigación sobre el Genoma Humano, UNAM Juriquilla, Querétaro, México

The International Laboratory for Human Genome Research, LIIGH-UNAM (www.liigh.unam.mx) offers a tenure-track position at the level of Assistant Professor (Investigador Asociado C) to perform research, teaching and formation of human resources in the area of: “Genomics of Mendelian Diseases”

Applicants are expected to have a doctorate degree, postdoctoral experience related to the above mentioned area and a strong track record of peer-reviewed publications. Interested applicants must submit CV, email addresses of three references, and a three-page project to Dr. Rafael Palacios, Coordinator of LIIGH-UNAM (palacios@liigh.unam.mx) before June 21, 2019 ………………………………………………………………

Tenure Track position in Genomic Sciences

Laboratorio Internacional de Investigación sobre el Genoma Humano, UNAM Juriquilla, Querétaro, México

The International Laboratory for Human Genome Research, LIIGH-UNAM (www.liigh.unam.mx) offers a tenure-track position at the level of Assistant Professor (Investigador Asociado C) to perform research, teaching and formation of human resources in the area of: “Statistic Population Genomics and its Impact in Complex Diseases”

Applicants are expected to have a doctorate degree, postdoctoral experience related to the above mentioned area and a strong track record of peer-reviewed publications. Interested applicants must submit CV, email addresses of three references, and a three-page statement of research interests to Dr. Rafael Palacios, Coordinator of LIIGH-UNAM (palacios@liigh.unam.mx) before June 21, 2019

#rasalsi #rasa In our Industrial program you will get Knowledge on RNA Seq, CHIP Seq,

Batch Starts From 18^th November 2019

#hurryup #registernow #enquirenow The primary goal of the industrial training program is to provide students with necessary skills making with employable. RASA LSI trains students with the enhanced skills required for them to excel in jobs in biotechnology, pharmaceuticals, BioIT and related industry sectors. At Rasa you will  learn from industry leaders how to apply these skills in life science & have a command over software developing process  by using various methodologies. For Registration visit us on: https://www.rasalsi.com/index.php/front-page/industrial-training/

Requirements
Doctoral degree in Bioinformatics, Computational Biology, (Bio)physics/-mathematics, Biochemistry/Biology or similar with strong quantitative and numeric focus
Ability to numerically process complex and large data sets
Good programming skills (R/Bioconductor and/or Python preferred, Linux is a plus)
Experience in analyzing next-generation sequencing data sets using network biology
Scientific publication record in applied bioinformatics
Familiarity with single cell NGS analyses and other –omics techniques is a plus, but not essential

https://github.com/MesquiteProject/MesquiteCore

Address of the bookmark: http://mesquiteproject.org/

An Institution of National Importance established by Dept. of
Biotechnology, Govt. of India Under the auspices of UNESCO

Advertisement No. RCB/IBDC/01/2020/Recruitment/HR

Recruitment For Contractual Positions Under The Project
Indian Biological Data Centre (IBDC) Phase-1

Regional Centre for Biotechnology (RCB) invites online applications from suitably qualified, dynamic, result-oriented and dedicated candidates for the following positions under the project Indian Biological Data Centre (BIDC) Phase-1 on contract basis:

Industry: Biotechnology

Location: Faridabad (Haryana, India)

Project Head - 1

Senior Scientist (Bioinformatics/ IT) - 1

For other details, visit: www.rcb.res.in. Last date for receipt of online application is 18th July 2020.

Registrar

Regional Centre for Biotechnology
Faridabad-Gurgaon Expressway,
Faridabad - 121001

• DNA-mapping*
• ChIP-seq*
• RNA-seq*
• ATAC-seq*
• scRNA-seq
• Hi-C
• Whole Genome Bisulfite Seq/WGBS

(*Also available in "allele-specific" mode)

snakePipes can be installed via conda :

'conda install -c mpi-ie -c bioconda -c conda-forge snakePipes'.

Source code (https://github.com/maxplanck-ie/snakepipes) and documentation (https://snakepipes.readthedocs.io/en/latest/) are available online.

Address of the bookmark: https://github.com/maxplanck-ie/snakepipes

Pay Matrix Level-12
No. of Post-01
(UR)
Post – Sr. Scientist
Area Bioinformatics
Age limit : 37 years
PhD in Computational Biology/Bioinformatics with 2 years experience in desired area
Or
ME/M.Tech in Bioinformatics or Genome Informatics or Genetic Engineering with 3 years experience in desired area
Experience of understanding fundamental science behind Artificial Intelligence, machine learning, novel Artificial Intelligence algorithms and architectures, software engineering principles for Artificial Intelligence, natural language processing with proficiency in programming as evident by publications in SCI journals with high impact factor. To be part a group of scientists working in the area of genomics, running the central
bioinformatics facility, developing independent projects and providing bioinformatics support to the user scientists of the Institute.

More at

http://14.139.62.50/CSIR-IITR%20Scientist%20Recruitment%20Adv%202020.pdf