Bioinformatics Textbook Track

Find more about Rosalind puzzle at http://rosalind.info/problems/list-view/?location=bioinformatics-textbook-track

I will provide solution of all the Rosalind problem with Perl for community.

Check out the right sidebar for more links ...

More at http://cpansearch.perl.org/src/TJPARNELL/

Address of the bookmark: http://cpansearch.perl.org/src/TJPARNELL/

More at https://bioinformaticsonline.com/snippets/view/42919/perl-ipcopen2-module

2. exec””

 syntax: exec "command";

3. Backticks “ or qx//

syntax: `command`;

syntax: qx/command/;

4. IPC::Open3

syntax: $output = open3(\*CHLD_IN, \*CHLD_OUT, \*CHLD_ERR, 'command arg1 arg2', 'optarg',...);

It is very similar to IPC::Open2 with the capability to capture all three file handles of the process, i.e., STDIN, STDOUT, and STDERR. It can also be used with or without the shell. You can read about it more in the documentation: IPC::Open3.

$output = open3(my $o ut, my $in, 'command arg1 arg2');

OR without using the shell

$output = open3(my $out, my $in, 'command', 'arg1', 'arg2');

5.a2p

syntax: a2p [options] [awkscript]

There is a Perl utility known as a2p which translates awk command to Perl. It takes awk script as input and generates a comparable Perl script as the output. Suppose, you want to execute the following awk statement

awk '{$1 = ""; $2 = ""; print}' f1.txt

This statement gives error sometimes even after escaping the variables (\$1, \$2) but by using a2p it can be easily converted to Perl script:

For further information, you can read it’s documentation: a2p

More help at https://bioinformaticsonline.com/snippets/view/42920/perl-script-to-run-awk-inside-perl

6. system()

syntax: system( "command" );

It is also a Perl function (perlfunc) that executes a command and waits for it to get finished first and then resume the Perl script. The return value is the exit status of the command. It can be called in two ways:

system( "command arg1 arg2" );

OR

system( "command", "arg1", "arg2" );

HELP

Here are some useful Perl cheat sheets that can be used as a quick reference guide.-- https://www.pcwdld.com/perl-cheat-sheet

Install latest Perl (with supporting multithreading) and CPANMinus.

 $ cd
 $ git clone git://github.com/tokuhirom/plenv.git ~/.plenv
 $ git clone git://github.com/tokuhirom/Perl-Build.git ~/.plenv/plugins/perl-build/
 $ echo 'export PATH="$HOME/.plenv/bin:$PATH"' >> ~/.bashrc
 $ echo 'eval "$(plenv init -)"' >> ~/.bashrc
 $ source ~/.bashrc
 $ plenv install 5.18.1 -Dusethreads
 $ plenv rehash
 $ plenv global 5.18.1
 $ plenv install-cpanm

• git is a distributed revision control and source code management software which can help you to download files from GitHub server.
• echo means "print".
• >> means adding the output into the end of the file, while > means adding the output by overwriting the whole file. Please use> with additional cares.
• In Linux system, there are two types of outputs when you execute a command. One is called standard output (or sometimes STDOUT for short), and the other is a standard error (STDERR). 1> is for STDOUT only, 2> is for STDERR only, and &>means for both. In default > is the same to 1>.
• exec is execution.
• Remember to install Perl in supporting multithreading (with option -Dusethreads), which is important for many NGS analysis packages (e.g. Trinity). In this setting, you can use multiple CPU for Perl software.
• Install the CPAN (Comprehensive Perl Archive Network) manager software, CPANMinus, by install-cpanm.

You can use plenv global and plenv local to change the different version of Perl to fulfil different needs of your Perl software.

For example, if the specific version of Perl is not compatible with your script, you can switch to the different version by:

 $ plenv local 

• It is similar to set the local version of your script language when you use pyenv and rbenv as the following.

Put the following path into ~/.bashrc file.

export PERL5LIB="$HOME/.plenv/build/perl-5.18.1/lib"

Install BioPerl and PerlIO::gzip

CPANMinus is a very good Perl module manager, use cpanm to install BioPerl can save you a lot of time. Here are some useful modules:

$ cpanm Bio::Perl
$ cpanm Bio::SearchIO
$ cpanm PerlIO::gzip

For more information, please visit: https://github.com/tokuhirom/plenv

Perl one-liners are small and awesome Perl programs that fit in a single line of code and they do one thing really well. These things include changing line spacing, numbering lines, doing calculations, converting and substituting text, deleting and printing certain lines, parsing logs, editing files in-place, doing statistics, carrying out system administration tasks, updating a bunch of files at once, and many more. Perl one-liners will make you the shell warrior. Anything that took you minutes to solve, will now take you seconds!

perl -pe '$\="\n"'   
#double space a file

perl -pe '$_ .= "\n" unless /^$/'
#double space a file except blank lines

perl -pe '$_.="\n"x7'
#7 space in a line.

perl -ne 'print unless /^$/'
#remove all blank lines

perl -lne 'print if length($_) < 20'
#print all lines with length less than 20.

perl -00 -pe ''
#If there are multiple spaces, delete all leaving one(make the file a single spaced file).

perl -00 -pe '$_.="\n"x4'
#Expand single blank lines into 4 consecutive blank lines

perl -pe '$_ = "$. $_"'
#Number all lines in a file

perl -pe '$_ = ++$a." $_" if /./'
#Number only non-empty lines in a file

perl -ne 'print ++$a." $_" if /./'
#Number and print only non-empty lines in a file

perl -pe '$_ = ++$a." $_" if /regex/'
#Number only lines that match a pattern

perl -ne 'print ++$a." $_" if /regex/'
#Number and print only lines that match a pattern

perl -ne 'printf "%-5d %s", $., $_ if /regex/'
#Left align lines with 5 white spaces if matches a pattern (perl -ne 'printf "%-5d %s", $., $_' : for all the lines)

perl -le 'print scalar(grep{/./}<>)'
#prints the total number of non-empty lines in a file

perl -lne '$a++ if /regex/; END {print $a+0}'
#print the total number of lines that matches the pattern

perl -alne 'print scalar @F'
#print the total number fields(words) in each line.

perl -alne '$t += @F; END { print $t}'
#Find total number of words in the file

perl -alne 'map { /regex/ && $t++ } @F; END { print $t }'
#find total number of fields that match the pattern

perl -lne '/regex/ && $t++; END { print $t }'
#Find total number of lines that match a pattern

perl -le '$n = 20; $m = 35; ($m,$n) = ($n,$m%$n) while $n; print $m'
#will calculate the GCD of two numbers.

perl -le '$a = $n = 20; $b = $m = 35; ($m,$n) = ($n,$m%$n) while $n; print $a*$b/$m'
#will calculate lcd of 20 and 35.

perl -le '$n=10; $min=5; $max=15; $, = " "; print map { int(rand($max-$min))+$min } 1..$n'
#Generates 10 random numbers between 5 and 15.

perl -le 'print map { ("a".."z",”0”..”9”)[rand 36] } 1..8'
#Generates a 8 character password from a to z and number 0 – 9.

perl -le 'print map { ("a",”t”,”g”,”c”)[rand 4] } 1..20'
#Generates a 20 nucleotide long random residue.

perl -le 'print "a"x50'
#generate a string of ‘x’ 50 character long

perl -le 'print join ", ", map { ord } split //, "hello world"'
#Will print the ascii value of the string hello world.

perl -le '@ascii = (99, 111, 100, 105, 110, 103); print pack("C*", @ascii)'
#converts ascii values into character strings.

perl -le '@odd = grep {$_ % 2 == 1} 1..100; print "@odd"'
#Generates an array of odd numbers.

perl -le '@even = grep {$_ % 2 == 0} 1..100; print "@even"'
#Generate an array of even numbers

perl -lpe 'y/A-Za-z/N-ZA-Mn-za-m/' file
#Convert the entire file into 13 characters offset(ROT13)

perl -nle 'print uc'
#Convert all text to uppercase:

perl -nle 'print lc'
#Convert text to lowercase:

perl -nle 'print ucfirst lc'
#Convert only first letter of first word to uppercas

perl -ple 'y/A-Za-z/a-zA-Z/'
#Convert upper case to lower case and vice versa

perl -ple 's/(\w+)/\u$1/g'
#Camel Casing

perl -pe 's|\n|\r\n|'
#Convert unix new lines into DOS new lines:

perl -pe 's|\r\n|\n|'
#Convert DOS newlines into unix new line

perl -pe 's|\n|\r|'
#Convert unix newlines into MAC newlines:

perl -pe '/regexp/ && s/foo/bar/'
#Substitute a foo with a bar in a line with a regexp.

Reference/Sources:

http://genomics-array.blogspot.in/2010/11/some-unixperl-oneliners-for.html

http://genomespot.blogspot.com/2013/08/a-selection-of-useful-bash-one-liners.html

http://biowize.wordpress.com/2012/06/15/command-line-magic-for-your-gene-annotations/

http://genomics-array.blogspot.com/2010/11/some-unixperl-oneliners-for.html

http://bioexpressblog.wordpress.com/2013/04/05/split-multi-fasta-sequence-file/

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Many of the Perl scripts require that the VCF files are compressed by bgzip and indexed by tabix (both tools are part of the tabix package, available for download here). The VCF files can be compressed and indexed using the following commands

bgzip my_file.vcf
tabix -p vcf my_file.vcf.gz

http://vcftools.sourceforge.net/perl_module.html

Address of the bookmark: http://vcftools.sourceforge.net/perl_module.html

Algorithms scripts @ https://github.com/jschendel/bioinformatics-algorithms-coursera

Address of the bookmark: https://github.com/jorvis/biocode

In our day to day research activity, we need to securely copy our data from several to local computer and visa-versa. I am jotting down some of the commonly used SCP command for your future help. Hope you all will like it

What is Secure Copy?

scp allows files to be copied to, from, or between different hosts. It uses ssh for data transfer and provides the same authentication and same level of security as ssh.

Examples

Copy the file "gene.txt" from a remote host to the local host

    $ scp your_username@remotehost.edu:gene.txt /some/local/directory

Copy the file "foobar.txt" from the local host to a remote host

    $ scp gene.txt your_username@remotehost.edu:/some/remote/directory

Copy the directory "chromosome" from the local host to a remote host's directory "bar"

    $ scp -r chromosome your_username@remotehost.edu:/some/remote/directory/bar

Copy the file "gene.txt" from remote host "rh1.edu" to remote host "rh2.edu"

    $ scp your_username@rh1.edu:/some/remote/directory/gene.txt \
    your_username@rh2.edu:/some/remote/directory/

Copying the files "gene.txt" and "cancer.txt" from the local host to your home directory on the remote host

    $ scp gene.txt cancer.txt your_username@remotehost.edu:~

Copy the file "gene.txt" from the local host to a remote host using port 2264

    $ scp -P 2264 gene.txt your_username@remotehost.edu:/some/remote/directory

Copy multiple files from the remote host to your current directory on the local host

    $ scp your_username@remotehost.edu:/some/remote/directory/\{a,b,c\} .

    $ scp your_username@remotehost.edu:~/\{gene.txt,cancer.txt\} .

scp Performance

By default scp uses the Triple-DES cipher to encrypt the data being sent. Using the Blowfish cipher has been shown to increase speed. This can be done by using option -c blowfish in the command line.

    $ scp -c blowfish some_file your_username@remotehost.edu:~

It is often suggested that the -C option for compression should also be used to increase speed. The effect of compression, however, will only significantly increase speed if your connection is very slow. Otherwise it may just be adding extra burden to the CPU. An example of using blowfish and compression:

    $ scp -c blowfish -C local_file your_username@remotehost.edu:~