sed ':a;N;$!ba;s/\n//g' filename.txt > newfilename_oneline.txt

To get average for a column of numbers (here the second column $2):

awk '{ sum += $2; n++ } END { if (n > 0) print sum / n; }'

To get sequence length for all sequences in a fasta file:

awk '/^>/ {if (seqlen){print seqlen}; print ;seqlen=0;next; } { seqlen = seqlen +length($0)}END{print seqlen}' \
filename.fasta

To copy (move, rename, etc) files based on their list in a text file:

cat file_list.txt | while read line; do cp "$line" complete_dataset/"$line"; done

To split bam files into sets with mapped and unmapped reads:

samtools view -F4 sample.bam > sample.mapped.sam
samtools view -f4 sample.bam > sample.unmapped.sam

To gzip all your fastq files using gnu parallel and gzip:

parallel gzip ::: *.fastq

To gzip all your fastq files using pigz:

pigz *.fastq

To count all sequences in a fasta file:

grep "^>" yourfile.fasta -c

To count all sequences in all fasta files in your current directory:

for a in *.fasta; do ls $a; grep "^>" -c $a; done

To keep only one copy of duplicated lines:

awk '!seen[$0]++'

To sum assembly size from SPAdes contigs.fasta or scaffolds.fasta file:

grep "^>" scaffolds.fasta | cut -f 4 -d '_' | paste -sd+ | bc

To remove everything after the first space at each line, e.g. to to simplify fasta headers:

cut -d' ' -f1 < your_file

To count reads in a all .fastq.gz files in your current folder (fast, using gnu parallel):

parallel "echo {} && gunzip -c {} | wc -l | awk '{d=\$1; print d/4;}'" ::: *.gz

To count reads in a all .fastq.gz files in your current folder:

zcat *.gz | echo $((`wc -l`/4))

To count reads in a all .fastq files in your current folder:

cat *.fastq | echo $((`wc -l`/4))

To count base pairs in a all .fastq.gz files in your current folder:

zcat *.fastq.gz | paste - - - - | cut -f 2 | tr -d '\n' | wc -c 

To split multifasta file into many fasta files:

awk '/^>/ {OUT=substr($0,2) ".fa"}; {print >> OUT; close(OUT)}' Input_File

To convert Illumina FASTQ 1.3 to 1.8:

sed -e '4~4y/@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\\]^_`abcdefghi/!"#$%&'\''()*+,-.\/0123456789:;<=>?@ABCDEFGHIJ/' f.fastq

To convert FASTQ to FASTA:

sed -n '1~4s/^@/>/p;2~4p' 

To get fastq read length distribution:

cat reads.fastq | awk '{if(NR%4==2) print length($1)}' | sort | uniq -c

To deinterleave interleaved fastq file:

cat myf.fq | paste - - - - - - - - | tee >(cut -f 1-4 | tr "\t" "\n" > myfile_1.fq) | cut -f 5-8 | \
tr "\t" "\n" > myf2.fq 

To filter and sort contig identifiers from SPAdes assembly (e.g. here lenght >= 4000 + coverage >=100):

grep "^>" scaffolds.fasta | sed s"/_/ /"g | awk '{ if ($4 >= 4000 && $6 >= 100) print $0 }' | sort -k 4 -n | \
sed s"/ /_/"g

To append something to all headers of your fasta files:

sed 's/>.*/&YOURSTRING/' filename.fasta > new_filename.fasta

To replace/squeeze multiple adjacent spaces by only one space: 

tr -s " " < file

To filter fastq based on length (here larger than or equal to 21, but smaller than or equal to 25.

cat your.fastq | paste - - - - | awk 'length($2)  >= 21 && length($2) <= 25' | sed 's/\t/\n/g' > filtered.fastq

To print difference between the last and first row in 5th column:

awk '{if (!first){first=$5;}; last=$5;} END {print last-first}' myfile.txt

To sample only 200 first bases from all sequences in a multifasta file (e.g. from assembly scaffolds.fasta file here):

awk '/^>/{ seqlen=0; print; next; } seqlen < 200 { if (seqlen + length($0) > 200) $0 = substr($0, 1, 200-seqlen);\
 seqlen += length($0); print }' scaffolds.fasta > 200bp_scaffolds.fasta

 To pipe a compressed fasta file directly into makeblastdb.

gunzip -c fasta.gz | makeblastdb -in -

To remove sequences with duplicate fasta headers from a fasta file.

awk '/^>/{f=!d[$1];d[$1]=1}f' in.fasta > out.fasta

1. Learn and get updated

Some of the bad biological programmers only learn new technical or non-technical things when it’s absolutely necessary. The good biological programmers learn new technical skills proactively. But great biological programmers not only learn new technical skills on their own but also learn non-technical skills, and have an open mind to sources of knowledge that others may shut out.

In other concrete term, the bad biological programmer learn Perl's regular expression when they started a project on comparative genomics; the good biological programmer learned it a year before because it looked interesting; and the great biological programmer also read about the BioPerl packages, genomics, DNA string, genomic theories, or some similar course of study so that they could understand the results and explain it biologically.

2. Not a merely coder!!!

I often encountered with biological programmer who call themself a hard-core computer programmer and avoid biology. I can almost guarantee that if you are one of them then you are not doing research but merely writing "dry" codes.

According to my supervisor most of the computational biologist, don't know what they are doing biologically. Even they struggle to explain their own programs output and results. Therefore, It is highly advisable to learn basic of biology which can assist you to explain the result and understand your discovery. Always remember you are a researcher not a coder.

3. Be Social with biologist

The computational biologist spends most of the time in from of computers, writing codes. They always think their job is to produce working codes, not technical research perfections. But, they are completely wrong. You should not forget that apart from your computational skills you also need some biologist, other than your supervisor, to explain and make you understand the complex biological mechanism.

I highly recommend your to interact with biotech researchers and learn how do they explain their one graph (which they generally produce after one year of work) biologically. Remember, the origin of your research project is complex biological phenomenon, which is more complex than that of your limited programming rules.

4. Do not search, research for answers

Researching for answers means more than typing several keywords into a search engine or posting a question at Stack Overflow or the BioStars forums. I have entered problems into search engines that generate no results, and every question I posted on Stack Overflow or the BioStars forums never got anything resembling an answer, yet I solved the issues and moved on. I’m not a magician — I just know how to find answers or discover root causes.

Many problems are situational, and if you depend on search engines and forums, you can waste a lot of time going down a rabbit hole and possibly never getting a solution. Learn to perform root cause analysis, learn enough about the underlying system to look for other clues and solutions, and learn to take a long distance view of an issue before deep diving into it.

5. Love and defend your research

You cannot rise to the top in this research profession without loving your work. There are some very good “it’s just a job” biological programmers (I’ve been one at times), but if that is your outlook, you won’t be willing to do whatever it takes to succeed. This idea gets a lot of folks in a huff, because they feel it is a personal insult. “I’m a good programmer, but I have other priorities and can’t make work my life.” I understand completely; I have other priorities too. As much as I hate to say it, when I am passionate about my work, I am willing (though not eager) to abandon my other priorities to finish the job. It is not an insult to say that if you aren’t willing to pull out all the stops you can’t be the best, it is a fact.

You must be passionate about more than programming — you must also be excited about your research, the tools and technology you are using, and so on. I have seen very good and even great biological programmers operating at mediocre levels because something was not a good fit, such as they hated the project or were using a technology they disliked. Therefore, like your research project and get excited about your discoveries. You have not only to discover but also defend your finding with scientific words.

Thanks to all of you for reading.

#!/usr/bin/perl

APPEAL:

listen (please, please);

open yourself, wide;
join (you, me),
connect (us,together),

tell me.

do something if distressed;

@dawn, dance;
@evening, sing;
read (books,$poems,stories) until peaceful;
study if able;

write me if-you-please;

sort your feelings, reset goals, seek (friends, family, anyone);

do*not*die (like this)
if sin abounds;

keys (hidden), open (locks, doors), tell secrets;
do not, I-beg-you, close them, yet.

accept (yourself, changes),
bind (grief, despair);

require truth, goodness if-you-will, each moment;

select (always), length(of-days)

# listen (a perl poem)
# Sharon Hopkins
# rev. June 19, 1995

CORE MODULES

Three modules make up the core engine for MCE.

MCE::Core

Provides the Core API for Many-Core Engine. The various MCE options are described here.

MCE::Signal

Temporary directory creation, cleanup, and signal handling.

MCE::Util

Utility functions for Many-Core Engine.

MCE EXTRAS

There are 4 add-on modules for use with MCE.

MCE::Candy

Provides a collection of sugar methods and output iterators for preserving output order.

MCE::Mutex

Provides a simple semaphore implementation supporting threads and processes.

MCE::Queue

Provides a hybrid queuing implementation for MCE supporting normal queues and priority queues from a single module. MCE::Queue exchanges data via the core engine to enable queuing to work for both children (spawned from fork) and threads.

MCE::Relay

Enables workers to receive and pass on information orderly with zero involvement by the manager process while running.

MCE MODELS

The models take Many-Core Engine to a new level for ease of use. Two options (chunk_size and max_workers) are configured automatically as well as spawning and shutdown.

MCE::Loop

Provides a parallel loop utilizing MCE for building creative loops.

MCE::Flow

A parallel flow model for building creative applications. This makes use of user_tasks in MCE. The author has full control when utilizing this model. MCE::Flow is similar to MCE::Loop, but allows for multiple code blocks to run in parallel with a slight change to syntax.

MCE::Grep

Provides a parallel grep implementation similar to the native grep function.

MCE::Map

Provides a parallel map model similar to the native map function.

MCE::Step

Provides a parallel step implementation utilizing MCE::Queue between user tasks. MCE::Step is a spin off from MCE::Flow with a touch of MCE::Stream. This model, introduced in 1.506, allows one to pass data from one sub-task into the next transparently.

MCE::Stream

Provides an efficient parallel implementation for chaining multiple maps and greps together through user_tasks and MCE::Queue. Like with MCE::Flow, MCE::Stream can run multiple code blocks in parallel with a slight change to syntax from MCE::Map and MCE::Grep.

MISCELLANEOUS

Miscellaneous additions included with the distribution.

MCE::Examples

Describes various demonstrations for MCE including a Monte Carlo simulation.

MCE::Subs

Exports functions mapped directly to MCE methods; e.g. mce_wid. The module allows 3 options; :manager, :worker, and :getter.

REQUIREMENTS

Perl 5.8.0 or later. PDL::IO::Storable is required in scripts running PDL.

SOURCE AND FURTHER READING

The source, cookbook, and examples are hosted at GitHub.

• https://github.com/marioroy/mce-perl

• https://github.com/marioroy/mce-cookbook

• https://github.com/marioroy/mce-examples

SEE ALSO

MCE::Shared provides data sharing capabilities for MCE. It includes MCE::Hobo for running code asynchronously.

• MCE::Shared

• MCE::Hobo

Address of the bookmark: https://github.com/marioroy/mce-examples

http://search.cpan.org/~lds/Bio-Graphics-2.37/

Address of the bookmark: http://search.cpan.org/~lds/Bio-Graphics-2.37/

Address of the bookmark: https://saliweb.readthedocs.io/en/latest/frontend.html

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Address of the bookmark: https://github.com/olarerin/metaPlotR