BOL: Related items

Retrieving Taxonomic Information with R

Rahul Nayak — Thu, 29 Aug 2019 01:38:39 -0500

This vignette will introduce users to the retrieval of taxonomic information with myTAI. The taxonomy() function implemented in myTAI relies on the powerful package taxize. Nevertheless, taxonomic information retrieval has been customized for the myTAI standard and for organism specific information retrieval.

Specifically, the taxonomy() function implemented in myTAI can be used to classify genomes according to phylogenetic classification into Phylostrata (Phylostratigraphy) or to retrieve species specific taxonomic information when performing Divergence Stratigraphy (see Introduction for details).

Address of the bookmark: https://cran.r-project.org/web/packages/myTAI/vignettes/Taxonomy.html

‘dockr’: the R container

Jit — Mon, 23 Dec 2019 09:56:49 -0600

dockr 0.8.6 is now available on CRAN. dockr is a minimal toolkit to build a lightweight Docker container image for your R package, in which the package itself is available. The Docker image seeks to mirror your R session as close as possible with respect to R specific dependencies. Both dependencies on CRAN R packages as well as local non-CRAN R packages will be included in the Docker container image.

If you want to know, how Docker works, and why you should consider using Docker, please take a look at the Docker website.

Address of the bookmark: https://www.docker.com/why-docker

Post Doc Computational Biology, Bioinformatics - Network Biology & Data Science, NGS (m/f/d)

Sat, 15 Feb 2020 06:13:35 -0600

https://www.jobvector.de/jobs-stellenangebote/biologie-life-sciences/forschung-entwicklung/post-doc-computational-biology-bioinformatics-network-biology-data-science-ngs-129867.html?suid=e522e9793b41817e52ac58d6963b94e2519920df

Requirements
Doctoral degree in Bioinformatics, Computational Biology, (Bio)physics/-mathematics, Biochemistry/Biology or similar with strong quantitative and numeric focus
Ability to numerically process complex and large data sets
Good programming skills (R/Bioconductor and/or Python preferred, Linux is a plus)
Experience in analyzing next-generation sequencing data sets using network biology
Scientific publication record in applied bioinformatics
Familiarity with single cell NGS analyses and other –omics techniques is a plus, but not essential

QuasR: Quantification and annotation of short reads in R

Neel — Fri, 13 Aug 2021 07:44:05 -0500

The QuasR package (short for Quantify and annotate short reads in R) integrates the functionality of several R packages (such as IRanges (Lawrence et al. 2013) and Rsamtools) and external software (e.g. bowtie, through the Rbowtie package, and HISAT2, through the Rhisat2 package). The package aims to cover the whole analysis workflow of typical high throughput sequencing experiments, starting from the raw sequence reads, over pre-processing and alignment, up to quantification. A single R script can contain all steps of a complete analysis, making it simple to document, reproduce or share the workflow containing all relevant details.

Address of the bookmark: https://www.bioconductor.org/packages/devel/bioc/vignettes/QuasR/inst/doc/QuasR.html

Biostats book !

Abhi — Mon, 14 Aug 2023 03:11:39 -0500

https://practical-stats-med-r.netlify.app/

Address of the bookmark: https://practical-stats-med-r.netlify.app/

Bioinformatics Scripts

Jit — Thu, 22 Jan 2015 22:29:39 -0600

Some of the useful bioinformatics scripts.

For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.

http://milkweedgenome.org/?q=scripts

Address of the bookmark: http://milkweedgenome.org/?q=scripts

Which Bioinformatics Journals Do You Follow?

Tenzin Paul — Fri, 10 Apr 2015 12:10:21 -0500

Which are your favorite bioinformatics journals? The ones that you check every month or so, or that you are subscribed to?

BINC Sample Question Paper !!!

Jitendra Narayan — Thu, 16 Apr 2015 09:15:09 -0500

BINC sample question paper round THREE ...

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Clump Finding Problem Solved with Perl

Jit — Wed, 10 Jun 2015 00:17:17 -0500

The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl