BOL: Related items

AlfaPang: alignment free algorithm for pangenome graph construction

BioStar — Thu, 28 Aug 2025 02:56:35 -0500

AlfaPang constructs variation graphs, leveraging its alignment-free and reference-free approach, based solely on intrinsic sequence properties. This design allows AlfaPang's runtime and memory usage to scale linearly with the size of input sequences, enabling it to handle significantly larger genome sets compared to other methods.

Address of the bookmark: https://github.com/AdamCicherski/AlfaPang

PPanGGOLiN: Depicting microbial species diversity via a Partitioned PanGenome Graph Of Linked Neighbors

LEGE — Thu, 01 Feb 2024 00:24:32 -0600

PPanGGOLiN (Gautreau et al. 2020) is a software suite used to create and manipulate prokaryotic pangenomes from a set of either genomic DNA sequences or provided genome annotations. It is designed to scale up to tens of thousands of genomes. It has the specificity to partition the pangenome using a statistical approach rather than using fixed thresholds which gives it the ability to work with low-quality data such as Metagenomic Assembled Genomes (MAGs) or Single-cell Amplified Genomes (SAGs) thus taking advantage of large scale environmental studies and letting users study the pangenome of uncultivable species.

A complete documentation is available here.

Address of the bookmark: https://github.com/labgem/PPanGGOLiN

odgi: optimized dynamic genome/graph implementation

Abhimanyu Singh — Tue, 01 Feb 2022 23:42:21 -0600

odgi provides an efficient and succinct dynamic DNA sequence graph model, as well as a host of algorithms that allow the use of such graphs in bioinformatic analyses.

Careful encoding of graph entities allows odgi to efficiently compute and transform pangenomes with minimal overheads. odgi implements a dynamic data structure that leveraged multi-core CPUs and can be updated on the fly.

The edges and path steps are recorded as deltas between the current node id and the target node id, where the node id corresponds to the rank in the global array of nodes. Graphs built from biological data sets tend to have local partial order and, when sorted, the deltas be small. This allows them to be compressed with a variable length integer representation, resulting in a small in-memory footprint at the cost of packing and unpacking.

The RAM and computational savings are substantial. In partially ordered regions of the graph, most deltas will require only a single byte.

Address of the bookmark: https://github.com/pangenome/odgi

Graph Genome Suite

Jit — Fri, 28 Oct 2016 07:59:54 -0500

Seven Bridges is the biomedical data analysis company accelerating breakthroughs in genomics research for cancer, drug development and precision medicine. We build self-improving systems to analyze millions of genomes, including the Graph Genome Suite — the most advanced population genomics tools in the world.

Address of the bookmark: https://www.sbgenomics.com/graph/

Rectangle Graph for Repeat Resolution in Genome Assembly

Rahul Nayak — Thu, 28 Dec 2017 09:43:03 -0600

Ultimate tool for resolving repeats in genome assemblies.

Though the specific implementation of the idea of the rectangle graph approach is already included into the current SPAdes distribution, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.

For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner. From de Bruijn Graphs to Rectangle Graphs for Genome Assembly, Lecture Notes in Bioinformatics 7534 (2012), pp. 249-261.

Address of the bookmark: http://bioinf.spbau.ru/en/rectangles

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph

Jit — Wed, 14 Nov 2018 04:50:27 -0600

MEGAHIT is a single node assembler for large and complex metagenomics NGS reads, such as soil. It makes use of succinct de Bruijn graph (SdBG) to achieve low memory assembly. MEGAHIT can optionally utilize a CUDA-enabled GPU to accelerate its SdBG contstruction. The GPU-accelerated version of MEGAHIT has been tested on NVIDIA GTX680 (4G memory) and Tesla K40c (12G memory) with CUDA 5.5, 6.0 and 6.5. MEGAHIT v1.0 or greater also supports IBM Power PC and has been tested on IBM POWER8.

https://academic.oup.com/bioinformatics/article/31/10/1674/177884

Address of the bookmark: https://github.com/voutcn/megahit

JumboDB: tool for de Bruijn graph construction

BioStar — Tue, 17 Aug 2021 13:33:46 -0500

jumboDB tool for fast de Bruijn graph construction from long sequences (reads or genomes) with very low error rate. JumboDB is not a genome assembler by itself but rather a subroutine that translates a set of reads into compressed de Bruijn graph.

More at https://github.com/AntonBankevich/jumboDB

Address of the bookmark: https://github.com/AntonBankevich/jumboDB

R Graphs !!

Jit — Fri, 04 Nov 2016 10:48:00 -0500

The blog is a collection of script examples with example data and output plots. R produce excellent quality graphs for data analysis, science and business presentation, publications and other purposes. Self-help codes and examples are provided. Enjoy nice graphs !!

Address of the bookmark: http://rgraphgallery.blogspot.be/

PhyloGrapher - Graph Visualization Tool

Jit — Wed, 07 Mar 2018 18:11:25 -0600

PhyloGrapher is a program designed to visualize and study evolutionary relationships within families of homologous genes or proteins (elements). PhyloGrapher is a drawing tool that generates custom graphs for a given set of elements. In general, it is possible to use PhyloGrapher to visualize any type of relations between elements.

https://www.youtube.com/watch?v=WgufqYMHCvM

Address of the bookmark: http://www.atgc.org/PhyloGrapher/PhyloGrapher_Welcome.html