<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/42198?</link>
	<atom:link href="https://bioinformaticsonline.com/related/42198?" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44445/ppanggolin-depicting-microbial-species-diversity-via-a-partitioned-pangenome-graph-of-linked-neighbors</guid>
	<pubDate>Thu, 01 Feb 2024 00:24:32 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44445/ppanggolin-depicting-microbial-species-diversity-via-a-partitioned-pangenome-graph-of-linked-neighbors</link>
	<title><![CDATA[PPanGGOLiN: Depicting microbial species diversity via a Partitioned PanGenome Graph Of Linked Neighbors]]></title>
	<description><![CDATA[<p dir="auto"><span>PPanGGOLiN</span>&nbsp;(<a href="https://doi.org/10.1371/journal.pcbi.1007732">Gautreau et al. 2020</a>) is a software suite used to create and manipulate prokaryotic pangenomes from a set of either genomic DNA sequences or provided genome annotations. It is designed to scale up to tens of thousands of genomes. It has the specificity to partition the pangenome using a statistical approach rather than using fixed thresholds which gives it the ability to work with low-quality data such as&nbsp;<em>Metagenomic Assembled Genomes (MAGs)</em>&nbsp;or&nbsp;<em>Single-cell Amplified Genomes (SAGs)</em>&nbsp;thus taking advantage of large scale environmental studies and letting users study the pangenome of uncultivable species.</p>
<p dir="auto">A complete documentation is available&nbsp;<a href="https://ppanggolin.readthedocs.io/">here</a>.</p>
<p dir="auto" style="text-align: center;"><a href="https://github.com/labgem/PPanGGOLiN/blob/master/docs/_static/logo.png" target="_blank"><img src="https://github.com/labgem/PPanGGOLiN/raw/master/docs/_static/logo.png" alt="logo" style="border: 0px;"></a></p><p>Address of the bookmark: <a href="https://github.com/labgem/PPanGGOLiN" rel="nofollow">https://github.com/labgem/PPanGGOLiN</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44887/alfapang-alignment-free-algorithm-for-pangenome-graph-construction</guid>
	<pubDate>Thu, 28 Aug 2025 02:56:35 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44887/alfapang-alignment-free-algorithm-for-pangenome-graph-construction</link>
	<title><![CDATA[AlfaPang: alignment free algorithm for pangenome graph construction]]></title>
	<description><![CDATA[<p><span>AlfaPang constructs variation graphs, leveraging its alignment-free and reference-free approach, based solely on intrinsic sequence properties. This design allows AlfaPang's runtime and memory usage to scale linearly with the size of input sequences, enabling it to handle significantly larger genome sets compared to other methods.</span></p><p>Address of the bookmark: <a href="https://github.com/AdamCicherski/AlfaPang" rel="nofollow">https://github.com/AdamCicherski/AlfaPang</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/45267/when-thousands-of-bacterial-genomes-become-one-giant-map</guid>
	<pubDate>Thu, 27 Aug 2026 10:56:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/45267/when-thousands-of-bacterial-genomes-become-one-giant-map</link>
	<title><![CDATA[When Thousands of Bacterial Genomes Become One Giant Map]]></title>
	<description><![CDATA[<p>Imagine trying to understand a city by studying just one house.</p><p>You might learn a lot about that house&mdash;the rooms, the doors, the furniture&mdash;but you would miss the bigger story: the streets, the neighborhoods, and all the ways the city changes from one place to another.</p><p>Something similar happens when scientists study bacterial genomes one at a time.</p><p>Over the past decade, researchers have collected thousands of bacterial genomes. These genomes contain an enormous amount of information about how bacteria survive, adapt, and evolve. But comparing thousands of individual genomes can quickly become a computational maze.</p><p>That is where PANORAMA enters the story.</p><p>Developed by J&eacute;r&ocirc;me Arnoux and colleagues, PANORAMA is a computational tool designed to explore bacterial pangenomes&mdash;the complete collection of genetic possibilities found across a species or group of related organisms. Instead of looking at every genome as an isolated object, the approach represents their shared and variable genetic features as a graph.</p><p>Think of this graph as a giant subway map.</p><p>Some stations appear on almost every route. These represent genes that are highly conserved. Other stations appear only on certain routes, representing genes that some bacteria possess while others do not. By looking at the entire network, scientists can begin to see not just *what genes exist*, but how they are organized and how biological systems are distributed across populations.</p><p>The researchers put PANORAMA to the test using 941 genomes of Pseudomonas aeruginosa, a bacterium important in human health. They used the tool to investigate biological systems, including bacterial defense mechanisms against viruses known as bacteriophages. They then expanded the analysis to more than 6,000 genomes from four Enterobacteriaceae species.</p><p>The result is more than a faster way to process data.</p><p>PANORAMA allows researchers to ask a bigger question: What can an entire microbial species do, genetically speaking?</p><p>By comparing pangenomes, the researchers could identify systems shared between species as well as distinctive features. They could also find recurring genomic locations where genetic material is inserted&mdash;clues that may reveal common evolutionary processes.</p><p>And this is perhaps the most exciting part of the story.</p><p>Every bacterial genome is like a page in a huge evolutionary book. Until recently, reading thousands of those pages together was difficult. PANORAMA provides a way to turn those pages into a map, allowing scientists to see patterns that might disappear when each genome is studied separately.</p><p>The study, published in PLOS Computational Biology in July 2026, presents PANORAMA as a foundation for large-scale comparative pangenomics. The software and accompanying analysis resources are openly available, giving other researchers the opportunity to explore microbial diversity themselves.</p><p>So the story is not really about one bacterium or one genome.</p><p>It is about changing the way we look at life.</p><p>Instead of asking, &ldquo;What is inside this genome?&rdquo;, scientists can increasingly ask, &ldquo;What is the full genetic landscape of this species&mdash;and how did it become this way?&rdquo;</p><p>And sometimes, when you stop looking at one house and finally see the whole city, the most interesting discoveries are hiding in the streets between them.</p><p>Read more at&nbsp;https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1013856</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43736/odgi-optimized-dynamic-genomegraph-implementation</guid>
	<pubDate>Tue, 01 Feb 2022 23:42:21 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43736/odgi-optimized-dynamic-genomegraph-implementation</link>
	<title><![CDATA[odgi: optimized dynamic genome/graph implementation]]></title>
	<description><![CDATA[<p dir="auto"><code>odgi</code>&nbsp;provides an efficient and succinct dynamic DNA sequence graph model, as well as a host of algorithms that allow the use of such graphs in bioinformatic analyses.</p>
<p dir="auto">Careful encoding of graph entities allows&nbsp;<code>odgi</code>&nbsp;to efficiently compute and transform&nbsp;<a href="https://pangenome.github.io/">pangenomes</a>&nbsp;with minimal overheads.&nbsp;<code>odgi</code>&nbsp;implements a dynamic data structure that leveraged multi-core CPUs and can be updated on the fly.</p>
<p dir="auto">The edges and path steps are recorded as deltas between the current node id and the target node id, where the node id corresponds to the rank in the global array of nodes. Graphs built from biological data sets tend to have local partial order and, when sorted, the deltas be small. This allows them to be compressed with a variable length integer representation, resulting in a small in-memory footprint at the cost of packing and unpacking.</p>
<p dir="auto">The RAM and computational savings are substantial. In partially ordered regions of the graph, most deltas will require only a single byte.</p><p>Address of the bookmark: <a href="https://github.com/pangenome/odgi" rel="nofollow">https://github.com/pangenome/odgi</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/29583/graph-genome-suite</guid>
	<pubDate>Fri, 28 Oct 2016 07:59:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/29583/graph-genome-suite</link>
	<title><![CDATA[Graph Genome Suite]]></title>
	<description><![CDATA[<p><span>Seven Bridges is the biomedical data analysis company accelerating breakthroughs in genomics research for cancer, drug development and precision medicine. We build self-improving systems to analyze millions of genomes, including the&nbsp;</span><strong>Graph Genome Suite</strong><span>&nbsp;&mdash; the most advanced population genomics tools in the world.</span></p><p>Address of the bookmark: <a href="https://www.sbgenomics.com/graph/" rel="nofollow">https://www.sbgenomics.com/graph/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34925/rectangle-graph-for-repeat-resolution-in-genome-assembly</guid>
	<pubDate>Thu, 28 Dec 2017 09:43:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34925/rectangle-graph-for-repeat-resolution-in-genome-assembly</link>
	<title><![CDATA[Rectangle Graph for Repeat Resolution in Genome Assembly]]></title>
	<description><![CDATA[<p>Ultimate tool for resolving repeats in genome assemblies.</p>
<p>Though the specific implementation of the idea of the rectangle graph approach is already included into the&nbsp;<a href="http://bioinf.spbau.ru/spades">current SPAdes distribution</a>, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.</p>
<p>For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner.&nbsp;<a href="http://www.springerlink.com/content/e617788h25u36440/">From de Bruijn Graphs to Rectangle Graphs for Genome Assembly</a>,&nbsp;<em>Lecture Notes in Bioinformatics</em>&nbsp;7534 (2012), pp. 249-261.</p><p>Address of the bookmark: <a href="http://bioinf.spbau.ru/en/rectangles" rel="nofollow">http://bioinf.spbau.ru/en/rectangles</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40713/glia-a-graphsmith-waterman-partial-order-alignerrealigner</guid>
	<pubDate>Tue, 28 Jan 2020 04:02:58 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40713/glia-a-graphsmith-waterman-partial-order-alignerrealigner</link>
	<title><![CDATA[Glia: a Graph/Smith-Waterman (partial order) aligner/realigner]]></title>
	<description><![CDATA[<p><span>glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.&nbsp;</span></p>
<p><span>More at&nbsp;<a href="https://github.com/ekg/glia">https://github.com/ekg/glia</a></span></p>
<pre><code>glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA</code></pre><p>Address of the bookmark: <a href="https://github.com/ekg/glia" rel="nofollow">https://github.com/ekg/glia</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37223/chopstitch-exon-annotation-and-splice-graph-construction-using-transcriptome-assembly-and-whole-genome-sequencing-data</guid>
	<pubDate>Tue, 03 Jul 2018 04:14:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37223/chopstitch-exon-annotation-and-splice-graph-construction-using-transcriptome-assembly-and-whole-genome-sequencing-data</link>
	<title><![CDATA[ChopStitch: exon annotation and splice graph construction using transcriptome assembly and whole genome sequencing data]]></title>
	<description><![CDATA[ChopStitch is a new method for finding putative exons and constructing splice graphs using an assembled transcriptome and whole genome shotgun sequencing (WGSS) data. ChopStitch identifies exon-exon boundaries in de novo assembled RNA-seq data with the help of a Bloom filter that represents the k-mer spectrum of WGSS reads. The algorithm also detects base substitutions in transcript sequences corresponding to sequencing or assembly errors, haplotype variations, or putative RNA editing events. The primary output of our tool is a FASTA file containing putative exons. Further, exon edges are interrogated for alternative exon-exon boundaries to detect transcript isoforms, which are reported as splice graphs in dot output format.<p>Address of the bookmark: <a href="https://github.com/bcgsc/ChopStitch" rel="nofollow">https://github.com/bcgsc/ChopStitch</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42806/graphunzip-phases-an-assembly-graph-using-hi-c-data-andor-long-reads</guid>
	<pubDate>Fri, 05 Feb 2021 21:22:24 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42806/graphunzip-phases-an-assembly-graph-using-hi-c-data-andor-long-reads</link>
	<title><![CDATA[GraphUnzip: Phases an assembly graph using Hi-C data and/or long reads.]]></title>
	<description><![CDATA[<p>GraphUnzip, a fast, memory-efficient and accurate tool to unzip assembly graphs into their constituent haplotypes using long reads and/or Hi-C data. As GraphUnzip only connects sequences in the assembly graph that already had a potential link based on overlaps, it yields high-quality gap-less supercontigs. To demonstrate the efficiency of GraphUnzip, we tested it on a simulated diploid Escherichia coli genome, and on two real datasets for the genomes of the rotifer Adineta vaga and the potato Solanum tuberosum. In all cases, GraphUnzip yielded highly continuous phased assemblies.</p>
<p>https://www.biorxiv.org/content/biorxiv/early/2021/02/01/2021.01.29.428779.full.pdf</p><p>Address of the bookmark: <a href="https://github.com/nadegeguiglielmoni/GraphUnzip" rel="nofollow">https://github.com/nadegeguiglielmoni/GraphUnzip</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44497/graphpath-a-graph-attention-model-for-molecular-stratification-with-interpretability-based-on-the-pathway-pathway-interaction-network</guid>
	<pubDate>Wed, 27 Mar 2024 20:51:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44497/graphpath-a-graph-attention-model-for-molecular-stratification-with-interpretability-based-on-the-pathway-pathway-interaction-network</link>
	<title><![CDATA[GraphPath: A graph attention model for molecular stratification with interpretability based on the pathway-pathway interaction network]]></title>
	<description><![CDATA[<p><span>Achieving accurate and interpretable clinical predictions requires paramount attention to thoroughly characterizing patients at both the molecular and biological pathway levels. In this paper, we present GraphPath, a biological knowledge-driven graph neural network with multi-head self-attention mechanism that implements the pathway-pathway interaction network. We train GraphPath to classify the cancer status of patients with prostate cancer based on their multi-omics profiling.</span></p>
<p><span><img src="https://github.com/amazingma/GraphPath/raw/main/Figures/GraphPath.png" alt="image" style="border: 0px;"></span></p><p>Address of the bookmark: <a href="https://github.com/amazingma/GraphPath" rel="nofollow">https://github.com/amazingma/GraphPath</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>

</channel>
</rss>