Check out the changes they made.

They added the cleanup-blastdb-volumes.py script to remove unused BLAST database volumes. Read the documentation here.

They also switched the protocol from ftp to https to access BLAST databases for increased performance and reliability when downloading data from the NCBI with the update_blastdb.pl script.

And fixed a few bugs related to downloading data from the NCBI, and mt_mode crashing blastn and blastx.

Check out the release notes.

Download BLAST+ 2.14.1

Questions or comments? Please write the BLAST help desk.

More info and download: https://blast.ncbi.nlm.nih.gov/doc/blast-news/2023-BLAST-News.html

sudo /etc/init.d/apache2 stop

sudo /etc/init.d/mysql stop

sudo /etc/init.d/proftpd stop

sudo /opt/lampp/lampp start

PhpMyAdmin “Wrong permissions on configuration file, should not be world writable!”

Once the Xammp is installed, it might be possible to set up the configuration file in writable mode. Try the following steps:

Just chmod 0755 the file

sudo chmod 0755 config.inc.php

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!

Pay Scale: Pay Band Rs.15600-39100 with AGP of Rs.6,000/-

Essential Qualifications for Professors, Associate Professors, and Assistant Professors: As per “UGC REGULATIONS ON MINIMUM QUALIFICATIONS FOR APPOINTMENT OF TEACHERS AND OTHER ACADEMIC STAFF IN UNIVERSITIES AND COLLEGES AND MEASURES FOR THE MAINTENANCE OF STANDARDS IN HIGHER EDUCATION 2010“ and the 2nd Amendments to the regulation issued in June 2013.

For details: http://www.ugc.ac.in/oldpdf/regulations/revised_finalugcregulationfinal10.pdf http://www.ugc.ac.in/pdfnews/8539300_English.pdf and University rules.

Procedure to apply:

Application forms along with API form complete in all respect along with necessary documents and application fee of Rs. 500/-. (Rs. 250/- for Scheduled Caste/Scheduled Tribe/Person with disabilities) should be sent to:

Registrar, Central University of Punjab, City Campus, Mansa Road, Bathinda-151001

For more info visit: http://www.centralunipunjab.com/Teaching/Final%20Details-t10-2013.pdf, http://www.centralunipunjab.com/Teaching/Advertisement-t10-2013.jpg

Last Apply Date: 31 Dec 2014

http://www.broadinstitute.org/igv/

Address of the bookmark: https://wikis.utexas.edu/display/bioiteam/Integrative+Genomics+Viewer+%28IGV%29+tutorial

 http://cosmos.hms.harvard.edu/.

Address of the bookmark: https://cosmos.hms.harvard.edu/

More at http://ncb.qau.edu.pk/

ADVERTISEMENT NO: NITR/SR/CH-BIF/2014/30

Applications are invited on prescribed format for the following assignment in a purely time bound research project undertaken in the Department of Biotechnology & Medical Engineering of the Institute.

1. Name of the Temporary Post : Senior Research Fellow-01
2. Name of the Research Project: “ Bioinformatics Infrastructure Facility (BIF)”
3. Name of the Sponsoring Agency: DBT, Government of India, 4 Tenure of the Project : 12th Five year Plan
5 Tenure of the Assignment : 01 year [Likely to be extended for 04 more years]
6 Job Description : BIF Maintenance and Active Research in Bioinformatics
7. Consolidated monthly compensation / Fellowship: Rs.18,000/- P.M.

8. Essential Qualifications and experience: B.Tech with valid GATE Score or M.Tech degree in Biotechnology/Bioinformatics/Computer Science/Computational Biology
9. Desirable Qualifications/ Experiences: Experience of Programming in PERL,R, Python, Unix and Visual Studio + Knowledge in NGS data analysis work flows ,WGS and statistical packages such as CRAN-R,MATLAB etc.

10. Accommodation : Bachelor accommodation in the Institute may be provided subject to availability.
11. For technical information on the project, the candidate may contact the Principal Investigator at the following address:

Name : Prof. Mukesh K Gupta
Address : Dept. of Biotechnology & Medical Engineering,
N.I.T.Rourkela-769 008
Telephone No : 0661-2462294
E-mail : guptam@nitrkl.ac.in

Eligible persons may apply in the prescribed format (available in the Institute Website)affixed with coloured photographs to be submitted in duplicate along with photo copies of relevant certificates, grade/ mark sheets, publications etc., to Asst. Registrar, SRICCE,
National Institute of Technology, Rourkela–769 008 before 22.08.2014. The cover should be super- scribed clearly the post applied for & Name of the Project.

Mere possession of minimum qualification does not guarantee invitation to the interview.
Candidates will be short listed based on merit and need of the project.

Advertisement:

http://www.nitrkl.ac.in/IntraWeb/Jobs_Tenders/Jobs/ProjectFellowship/2014/141707192838_1.pdf

Studentship and Traineeship in Bioinformatics

Applications are invited on plain paper from suitable candidates for Studentship and Traineeship (One each) at Bioinformatics Sub-Center as detailed below:

1. Studentship: Studentship is for those who have completed M. Sc. Degrees in Life Science.

Number of seats : One

Duration : Six months

Eligibility : Passed M.Sc. degree in Life Sciences.

Fellowship : Rs. 5000/- (Five thousand only) per month

2. Traineeship: Traineeship is for those who have completed M. Sc. Degrees in Life Science/Registered Ph. D. student in Life Sciences.

Number of seats : One

Duration : Six months

Eligibility : Passed M.Sc. degree in Life Sciences/ Registered Ph. D. student in Life Sciences

Fellowship : Rs. 5000/- (Five thousand only) per month

Preferences will be given to person who has experience in Bioinformatics and Computer
sciences. The application along with detailed bio-data should reach the undersigned, on or before 25th August 2014. Both, the studentship and the traineeship are temporary, will be discontinued after the six months from the date of Joining. It may be discontinued in-between without any notice, if the work is not found satisfactory.

Advertisement www.bioinfobubpl.nic.in/Advertisement_st.pdf