Core_nt contains the same eukaryotic transcript and gene-related sequences as nt. The core_nt database is nt without most eukaryotic chromosome sequences. Most nucleotide BLAST searches with core_nt will be similar to the nt database. However, core_nt is better than nt for accomplishing your most common BLAST search goals, such as identifying gene-related sequences like transcript sequences and complete bacterial chromosomes. This is because, in recent years, nt has acquired more low-relevance, non-annotated, and non-gene content. 

Learn more: https://ncbiinsights.ncbi.nlm.nih.gov/2024/07/18/new-blast-core-nucleotide-database/

Tasks:  239 total,   1 running,  238 sleeping,   0 stopped,   0 zombie

This line tells you how many processes are running. If you are using laptops machines it’s not so interesting because you really are the only one using this machine.

Cpu(s):  0.0%us,  0.0%sy,  0.0%ni,100.0%id,  0.0%wa,  0.0%hi,  0.0%si,  0.0%st

This line contains the CPU load. The first two numbers are how busy the system is doing computation (“us” stands for “user”) and how busy the system is doing system-y things like accessing disks or network (“sy” stands for “system”). We’ll talk more about this later.

Mem:   49457320k total,    3492174k used,  14535596k free,    1435148k buffers

This should be easy to understand – how much memory you’re using!

Swap:   539356k total,   28332k used,   836562k free,    29862014k cached

Swap is just on-disk memory that can be used to “swap” out programs from main memory. Again, we’ll talk about this later.:

PID USER      PR  NI  VIRT  RES  SHR S %CPU %MEM    TIME+  COMMAND
  1 root      39   19  0  0  0 S  0.0  0.0   246:57.22 kipmi0
  2 root      RT   0     0    0    0 S  0.0  0.0   0:00.00 migration/0

And... finally! What’s actually running! The two most important numbers are the %CPU and %MEM towards the right, as well as the COMMAND. This tells you how compute- and memory-intensive your program is. Right now, nothing’s running so the numbers aren’t very interesting, but just wait until we run something...

A fairly complete on-line guide to BLAST searching can be found at the NCBI BLAST Help Manual. For a theoretical overview of BLAST, see the NCBI BLAST Course. Additional information can be found in the BLAST 2.0 Release Notes

Supported and Suggested Values for Gap Open and Extension in BLASTP, BLASTX, TBLASTN, and TBLASTX

Address of the bookmark: https://www.arabidopsis.org/Blast/BLASToptions.jsp

Check out the changes they made.

They added the cleanup-blastdb-volumes.py script to remove unused BLAST database volumes. Read the documentation here.

They also switched the protocol from ftp to https to access BLAST databases for increased performance and reliability when downloading data from the NCBI with the update_blastdb.pl script.

And fixed a few bugs related to downloading data from the NCBI, and mt_mode crashing blastn and blastx.

Check out the release notes.

Download BLAST+ 2.14.1

Questions or comments? Please write the BLAST help desk.

More info and download: https://blast.ncbi.nlm.nih.gov/doc/blast-news/2023-BLAST-News.html

Assistant Professor in Bioinformatics

Essential :
First Class Master’s Degree in the appropriate branch of Life Sciences / Technology (Tech.)
OR
Ph.D in Life Sciences or in the respective subject area of specialization
OR
Good Academic record with at least 55% marks (or an equivalent grade) at the Master’s Degree level, in the relevant subject or an equivalent degree from an Indian / Foreign University.
Besides fulfilling the above qualifications, candidates should have cleared the eligibility test (NET) for lecturers conducted by the UGC, CSIR or similar test accredited by the UGC and as per the requirements of UGC guidelines.

Desirable :
Teaching, research industrial and/or professional experience in a reputed organization.
Papers presented at Conferences and/or in refereed journals

Note : Application are invited in prescribed form Click here for Application Form
Kindly send your applications to “Registrar, Dr. D. Y. Patil Vidyapeeth, Pune, Sant Tukaram Nagar, Pimpri, Pune – 411018., Maharashtra, India.” should reach in the University office within 15 days from the publication.

More Info: http://www.dpu.edu.in/BiotechResearchPositions.aspx

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!

As one of the leading research-intensive universities in China, ZJU is located in the beautiful city of Hangzhou. Successful candidates will be employed as Principal Investigators and are qualified to supervise doctoral students. ZJU will offer an internationally competitive salary and the opportunity to purchase university's apartment at a price much lower than the market price, and will provide office and laboratory spaces as well as internationally competitive research startup packages.

Qualified applicants are strongly encouraged to submit their applications electronically to tr@zju.edu.cn. Applicants should include the following materials in pdf format: a comprehensive CV, a statement of research and teaching plan, and a list of 3 to 5 references with detailed contact information.

Contact：Talents Office, ZJU

Tel：+86-571-88981345, +86-571-88981390

Fax：+86-571-88981976

E-mail:tr@zju.edu.cn

sudo /etc/init.d/apache2 stop

sudo /etc/init.d/mysql stop

sudo /etc/init.d/proftpd stop

sudo /opt/lampp/lampp start

PhpMyAdmin “Wrong permissions on configuration file, should not be world writable!”

Once the Xammp is installed, it might be possible to set up the configuration file in writable mode. Try the following steps:

Just chmod 0755 the file

sudo chmod 0755 config.inc.php