<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/4234?offset=90</link>
	<atom:link href="https://bioinformaticsonline.com/related/4234?offset=90" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38389/blast-options-setting-and-defaults</guid>
	<pubDate>Mon, 10 Dec 2018 08:29:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38389/blast-options-setting-and-defaults</link>
	<title><![CDATA[BLAST options, setting and defaults]]></title>
	<description><![CDATA[<p>BLAST stands for Basic Local Alignment Search Tool and was developed by Altschul et al. (1990) and significantly improved by&nbsp;<a href="http://www3.oup.co.uk/nar/Volume_25/Issue_17/freepdf/">Altschul et al. (1997).</a>&nbsp;It is a very fast search algorithm that is used to separately search protein or DNA databases. BLAST is best used for sequence similarity searching, rather than for motif searching. For searches using a query sequence of fewer than twenty residues,&nbsp;<a href="https://www.arabidopsis.org/servlets/tools/patmatch/">PatMatch</a>&nbsp;is the best choice. Another sequence alignment tool that may yield different results from BLAST, and may be useful for motif searching, is&nbsp;<a href="https://www.arabidopsis.org/cgi-bin/fasta/TAIRfasta.pl">FASTA</a>. To search nonplant datasets, try&nbsp;<a href="http://seqsim.ncgr.org/newBlast.html">NCGR BLAST</a>&nbsp;or&nbsp;<a href="http://www.ncbi.nlm.nih.gov/blast/blast.cgi?Jform=0">NCBI BLAST</a>.</p>
<p>A fairly complete on-line guide to BLAST searching can be found at the&nbsp;<a href="http://www.ncbi.nlm.nih.gov/BLAST/blast_help.html">NCBI BLAST Help Manual</a>. For a theoretical overview of BLAST, see the&nbsp;<a href="http://www.ncbi.nlm.nih.gov/BLAST/tutorial/Altschul-1.html">NCBI BLAST Course</a>. Additional information can be found in the&nbsp;<a href="https://www.arabidopsis.org/blast/aboutblast2.htm">BLAST 2.0 Release Notes</a></p>
<table border="1">
<tbody>
<tr><th>&nbsp;</th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">BLASTN</a></th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">BLASTP</a></th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">BLASTX</a></th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">TBLASTN</a></th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">TBLASTX</a></th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">PSIBLAST</a></th></tr>
<tr>
<td><a name="open" id="open"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#open"><strong>Gap opening penalty</strong></a>:<br>cost to open a gap [integer]</td>
<td align="center">default = 5</td>
<td align="center">default = 11<br>limited&nbsp;values&nbsp;are supported</td>
<td align="center">default = 11<br>limited&nbsp;values&nbsp;are supported</td>
<td align="center">default = 11<br>limited&nbsp;values&nbsp;are supported</td>
<td align="center">default = 11<br>limited&nbsp;values&nbsp;are supported</td>
<td align="center">default = 5</td>
</tr>
<tr>
<td><a name="extend" id="extend"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#extend"><strong>Gap extension penalty</strong></a>:<br>cost to extend a gap [integer]</td>
<td align="center">default = 2</td>
<td align="center">default = 1<br>a 0 in this field means to use the default</td>
<td align="center">default = 1<br>a 0 in this field means to use the default</td>
<td align="center">default = 1<br>a 0 in this field means to use the default</td>
<td align="center">default = 1<br>a 0 in this field means to use the default</td>
<td align="center">default = 2</td>
</tr>
<tr>
<td><a name="match" id="match"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#match"><strong>Nucleic match</strong></a>:<br>reward for a match in the BLAST portion of run [integer]</td>
<td align="center">default = 1</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">default = 1</td>
</tr>
<tr>
<td><a name="mismatch" id="mismatch"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#mismatch"><strong>Nucleic mismatch</strong></a>:<br>penalty for a mismatch in the blast portion of run [integer]</td>
<td align="center">default = -3</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">default = -3</td>
</tr>
<tr>
<td><strong><a name="expect" id="expect"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#expect">Expectation value</a></strong>:<br>(E) [real]</td>
<td align="center">default = 10.0</td>
<td align="center">default = 10.0</td>
<td align="center">default = 10.0</td>
<td align="center">default = 10.0</td>
<td align="center">default = 10.0</td>
<td align="center">default = 10.0</td>
</tr>
<tr>
<td><a name="word" id="word"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#word"><strong>Word size</strong></a>:<br>the size of the initial word that must be matched between the database and the query sequence</td>
<td align="center">default = 11</td>
<td align="center">default = 3</td>
<td align="center">default = 3</td>
<td align="center">default = 3</td>
<td align="center">default = 3</td>
<td align="center">default = 11</td>
</tr>
<tr>
<td><a name="descriptions" id="descriptions"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#descriptions"><strong>Max scores</strong></a>:<br>Number of one-line descriptions (V) [Integer]</td>
<td align="center">default = 25</td>
<td align="center">default = 25</td>
<td align="center">default = 25</td>
<td align="center">default = 25</td>
<td align="center">default = 25</td>
<td align="center">default = 25</td>
</tr>
<tr>
<td><strong><a name="alignments" id="alignments"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#alignments">Max alignments</a></strong>:<br>number of alignments to show (B) [integer]</td>
<td align="center">default = 15</td>
<td align="center">default = 15</td>
<td align="center">default = 15</td>
<td align="center">default = 15</td>
<td align="center">default = 15</td>
<td align="center">default = 15</td>
</tr>
<tr>
<td><strong>Query filter</strong>:<br>filter applied to the query sequence</td>
<td align="center">default = DUST</td>
<td align="center">default = SEG</td>
<td align="center">default = SEG</td>
<td align="center">default = SEG</td>
<td align="center">default = SEG</td>
<td align="center">default = DUST</td>
</tr>
<tr>
<td><strong><a name="gencodes" id="gencodes"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#gencodes">Query genetic code</a></strong>:<br>genetic code to be used in BLASTX translation of the query</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">default = universal</td>
<td align="center">default = universal</td>
<td align="center">default = universal</td>
<td align="center">n/a</td>
</tr>
<tr>
<td><strong><a name="matrix" id="matrix"></a><a href="http://twod.med.harvard.edu/seqanal/matrices.html">Matrix</a></strong>:<br>substitution matrix to be used for amino acid comparisons</td>
<td align="center">no default</td>
<td align="center">default = blosum62</td>
<td align="center">default = blosum62</td>
<td align="center">default = blosum62</td>
<td align="center">default = blosum62</td>
<td align="center">no default</td>
</tr>
</tbody>
</table>
<p>Supported and Suggested&nbsp;Values&nbsp;for Gap Open and Extension in BLASTP, BLASTX, TBLASTN, and TBLASTX</p>
<table border="1">
<tbody>
<tr><th>Gaps Open</th><th>Gap Extension</th></tr>
<tr>
<td align="center">10</td>
<td align="center">1</td>
</tr>
<tr>
<td align="center">10</td>
<td align="center">2</td>
</tr>
<tr>
<td align="center">11</td>
<td align="center">1</td>
</tr>
<tr>
<td align="center">8</td>
<td align="center">2</td>
</tr>
<tr>
<td align="center">9</td>
<td align="center">2</td>
</tr>
</tbody>
</table><p>Address of the bookmark: <a href="https://www.arabidopsis.org/Blast/BLASToptions.jsp" rel="nofollow">https://www.arabidopsis.org/Blast/BLASToptions.jsp</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12896/inspire-faculty-scheme-a-component-of-%E2%80%9Cassured-opportunity-for-research-career-aorc%E2%80%9D-under-inspire</guid>
  <pubDate>Sat, 19 Jul 2014 14:59:30 -0500</pubDate>
  <link></link>
  <title><![CDATA[INSPIRE Faculty Scheme: a component of “Assured Opportunity for Research Career (AORC)” under INSPIRE.]]></title>
  <description><![CDATA[
<p>Ministry of Science and Technology, Department of Science and Technology</p>

<p>7th ADVERTISEMENT – 2014 (2)</p>

<p>INSPIRE Faculty Scheme: a component of “Assured Opportunity for Research Career (AORC)” under INSPIRE.</p>

<p>The Department of Science and Technology, Government of India, has launched the “Innovation in Science Pursuit for Inspired Research (INSPIRE)” [http://www.inspire-dst.gov.in] program in 2008.</p>

<p>The program aims to attract talent for study of science and careers with research. INSPIRE includes many components. The importance of Assured Career Opportunity in R&amp;D sector has been recognized.</p>

<p>INSPIRE Faculty Scheme opens up an “Assured Opportunity for Research Career (AORC)” for young researchers in the age group of 27-32 years. It offers a contractual research awards to young achievers and opportunity for independent research in the near term and emerge as a future leader in the long term.</p>

<p>Eligibility</p>

<p>Essential Indian citizens and people of Indian origin including NRI/PIO status with PhD (in science, mathematics, engineering, pharmacy, medicine, and agriculture related subjects) from any recognized university in the world,</p>

<p>Those who have submitted their PhD Theses and are awaiting award of the degree are also<br />eligible. However, the award will be conveyed only after confirmation of the awarding the<br />PhD degree.</p>

<p>The upper age limit as on 1st July 2014 should be 32 years for considering support for a<br />period of 5 years. However, for SC and ST candidates, upper age limit will be 35 years.</p>

<p>Publication(s) in highly reputed Journals demonstrating research potential of the candidate.</p>

<p>Desirable</p>

<p>Candidates who are within top 1% at the School Leaving Examination, IIT-JEE rank, 1st Rank Holder either in graduation or post-graduation level university examination (which are used presently for identifying INSPIRE Scholars at under-graduate level and INSPIRE Fellows for doctoral degree)</p>

<p>More at http://www.inspire-dst.gov.in/faculty_scheme.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44370/ncbiblast-2141-now-available</guid>
	<pubDate>Wed, 30 Aug 2023 02:36:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44370/ncbiblast-2141-now-available</link>
	<title><![CDATA[NCBIBLAST+ 2.14.1 now available]]></title>
	<description><![CDATA[<p><a href="https://www.linkedin.com/feed/hashtag/?keywords=ncbiblast&amp;highlightedUpdateUrns=urn%3Ali%3Aactivity%3A7101231946264924160">#NCBIBLAST</a><span>+ 2.14.1 now available with improved documentation, faster and more reliable database downloads, and some bug fixes.&nbsp;</span></p><p>Check out the changes they made.</p><p>They added the&nbsp;<code><span>cleanup-blastdb-volumes.py</span></code>&nbsp;script to remove unused BLAST database volumes. Read the documentation&nbsp;<a href="https://www.ncbi.nlm.nih.gov/books/NBK592857/">here</a>.</p><p>They also switched the protocol from&nbsp;<code><span>ftp</span></code>&nbsp;to&nbsp;<code><span>https</span></code>&nbsp;to access BLAST databases for increased performance and reliability when downloading data from the NCBI with the&nbsp;<code><span>update_blastdb.pl</span></code>&nbsp;script.</p><p>And fixed a few bugs related to downloading data from the NCBI, and&nbsp;<code><span>mt_mode</span></code>&nbsp;crashing&nbsp;<code><span>blastn</span></code>&nbsp;and&nbsp;<code><span>blastx</span></code>.</p><p>Check out the&nbsp;<a href="https://www.ncbi.nlm.nih.gov/books/NBK131777/">release notes</a>.</p><p>Download&nbsp;<a href="https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.14.1/">BLAST+ 2.14.1</a></p><p>Questions or comments? Please write the&nbsp;<a href="https://support.nlm.nih.gov/support/create-case/">BLAST help desk</a>.</p><p><span><span>More info and download:</span>&nbsp;https://blast.ncbi.nlm.nih.gov/doc/blast-news/2023-BLAST-News.html</span></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11457/commercial-and-public-next-gen-seq-ngs-software</guid>
	<pubDate>Tue, 03 Jun 2014 20:45:11 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11457/commercial-and-public-next-gen-seq-ngs-software</link>
	<title><![CDATA[Commercial and public next-gen-seq (NGS) software]]></title>
	<description><![CDATA[<p><strong>Integrated solutions</strong><br /> <a href="http://www.clcbio.com/index.php?id=1240" target="_blank">CLCbio Genomics Workbench</a> - <em>de novo</em> and reference assembly of Sanger, Roche FLX, Illumina, Helicos, and SOLiD data. Commercial next-gen-seq software that extends the CLCbio Main Workbench software. Includes SNP detection, CHiP-seq, browser and other features. Commercial. Windows, Mac OS X and Linux.<br /><a href="http://g2.trac.bx.psu.edu/" target="_blank">Galaxy</a> - Galaxy = interactive and reproducible genomics. A job webportal.<br /> <a href="http://www.genomatix.de/products/index.html" target="_blank">Genomatix</a> - Integrated Solutions for Next Generation Sequencing data analysis.<br /> <a href="http://www.jmp.com/software/genomics/" target="_blank">JMP Genomics</a> - Next gen visualization and statistics tool from SAS. They are <a href="http://www.marketwatch.com/news/story/JMPR-Genomics-NCGR-Partnership-Foster/story.aspx?guid=%7B7AC9DE36-B6AA-4EDE-9CD5-633B29FE6154%7D" target="_blank">working with NCGR</a> to refine this tool and produce others.<br /> <a href="http://softgenetics.com/NextGENe.html" target="_blank">NextGENe</a> - <em>de novo</em> and reference assembly of Illumina, SOLiD and Roche FLX data. Uses a novel Condensation Assembly Tool approach where reads are joined via "anchors" into mini-contigs before assembly. Includes SNP detection, CHiP-seq, browser and other features. Commercial. Win or MacOS.<br /><a href="http://www.partek.com" target="_blank" title="Partek Incorporated">Partek</a>&nbsp;<span>- Commercial software for NGS, microarray, and qPCR data analysis. Streamlined analysis workflows for: ChIP-Seq, RNA-Seq, DNA-Seq, DNA Methylation, Gene Expression, Exon, miRNA Expression, Copy Number, Allele-Specific Copy Number, LOH, Association, Trio Analysis, and Tiling. Supports all commercial sequencing and microarray technologies.&nbsp;</span><br /> <a href="http://www.dnastar.com/products/SMGA.php" target="_blank">SeqMan Genome Analyser</a> - Software for Next Generation sequence assembly of Illumina, Roche FLX and Sanger data integrating with Lasergene Sequence Analysis software for additional analysis and visualization capabilities. Can use a hybrid templated/de novo approach. Commercial. Win or Mac OS X.<br /><a href="http://1001genomes.org/downloads/shore.html" target="_blank">SHORE</a> - SHORE, for Short Read, is a mapping and analysis pipeline for short DNA sequences produced on a Illumina Genome Analyzer. A suite created by the 1001 Genomes project. Source for POSIX.<br /> <a href="http://www.realtimegenomics.com/" target="_blank">SlimSearch</a> - Fledgling commercial product.<br />Synamatix has SXOligoSearch (<a href="http://synasite.mgrc.com.my:8080/sxog/NewSXOligoSearch.php" target="_blank">http://synasite.mgrc.com.my:8080/sxo...ligoSearch.php</a>)<br />The SWIFT suit is a software collection for fast index-based sequence comparison. It contains the following programs: SWIFT &mdash; fast local alignment search, guaranteeing to find epsilon-matches between two sequences; SWIFT BALSAM &mdash; a very fast program to find semiglobal non-gapped alignments based on k-mer seeds. <a href="http://bibiserv.techfak.uni-bielefeld.de/swift/" target="_blank">http://bibiserv.techfak.uni-bielefeld.de/swift/</a><br /><a href="http://http//bioinf.comav.upv.es/svn/biolib/biolib/src/" target="_blank">biolib</a>.is library and a set of script targeted to NGS. There are modules to: clean sequences (sanger, 454, ilumina), parse caf, ace and bowtie map files, clean and filter contigs, look for snps and indels., filter snps, do statistics for: reads, contigs and snps.</p><p><br /> <strong>Align/Assemble to a reference</strong><br /> <a href="https://secure.genome.ucla.edu/index.php/BFAST" target="_blank">BFAST</a> - Blat-like Fast Accurate Search Tool. Written by Nils Homer, Stanley F. Nelson and Barry Merriman at UCLA.<br /><a href="http://bowtie-bio.sourceforge.net/" target="_blank">Bowtie</a> - Ultrafast, memory-efficient short read aligner. It aligns short DNA sequences (reads) to the human genome at a rate of 25 million reads per hour on a typical workstation with 2 gigabytes of memory. Uses a Burrows-Wheeler-Transformed (BWT) index. <a href="http://seqanswers.com/forums/showthread.php?t=706" target="_blank">Link to discussion thread here</a>. Written by Ben Langmead and Cole Trapnell. Linux, Windows, and Mac OS X.<br /> <a href="http://maq.sourceforge.net/" target="_blank">BWA</a> - Heng Lee's BWT Alignment program - a progression from Maq. BWA is a fast light-weighted tool that aligns short sequences to a sequence database, such as the human reference genome. By default, BWA finds an alignment within edit distance 2 to the query sequence. C++ source.<br /> <a href="http://bioinfo.cgrb.oregonstate.edu/docs/solexa/" target="_blank">ELAND</a> - Efficient Large-Scale Alignment of Nucleotide Databases. Whole genome alignments to a reference genome. Written by Illumina author Anthony J. Cox for the Solexa 1G machine.<br /> <a href="http://www.ebi.ac.uk/%7Eguy/exonerate/" target="_blank">Exonerate</a> - Various forms of pairwise alignment (including Smith-Waterman-Gotoh) of DNA/protein against a reference. Authors are Guy St C Slater and Ewan Birney from EMBL. C for POSIX.<br /> <a href="http://1001genomes.org/downloads/genomemapper.html" target="_blank">GenomeMapper</a> - GenomeMapper is a short read mapping tool designed for accurate read alignments. It quickly aligns millions of reads either with ungapped or gapped alignments. A tool created by the 1001 Genomes project. Source for POSIX.<br /> <a href="http://www.gene.com/share/gmap/" target="_blank">GMAP</a> - GMAP (Genomic Mapping and Alignment Program) for mRNA and EST Sequences. Developed by Thomas Wu and Colin Watanabe at Genentec. C/Perl for Unix.<br /> <a href="http://dna.cs.byu.edu/gnumap/" target="_blank">gnumap</a> - The Genomic Next-generation Universal MAPper (gnumap) is a program designed to accurately map sequence data obtained from next-generation sequencing machines (specifically that of Solexa/Illumina) back to a genome of any size. It seeks to align reads from nonunique repeats using statistics. From authors at Brigham Young University. C source/Unix.<br /> <a href="http://sourceforge.net/projects/maq/" target="_blank">MAQ</a> - Mapping and Assembly with Qualities (renamed from MAPASS2). Particularly designed for Illumina with preliminary functions to handle ABI SOLiD data. Written by Heng Li from the Sanger Centre. Features extensive supporting tools for DIP/SNP detection, etc. C++ source<br /> <a href="http://bioinformatics.bc.edu/marthlab/Mosaik" target="_blank">MOSAIK</a> - MOSAIK produces gapped alignments using the Smith-Waterman algorithm. Features a number of support tools. Support for Roche FLX, Illumina, SOLiD, and Helicos. Written by Michael Str&ouml;mberg at Boston College. Win/Linux/MacOSX<br /> <a href="http://mrfast.sourceforge.net/" target="_blank">MrFAST and MrsFAST</a> - mrFAST &amp; mrsFAST are designed to map short reads generated with the Illumina platform to reference genome assemblies; in a fast and memory-efficient manner. Robust to INDELs and MrsFAST has a bisulphite mode. Authors are from the University of Washington. C as source.<br /> <a href="http://mummer.sourceforge.net/" target="_blank">MUMmer</a> - MUMmer is a modular system for the rapid whole genome alignment of finished or draft sequence. Released as a package providing an efficient suffix tree library, seed-and-extend alignment, SNP detection, repeat detection, and visualization tools. Version 3.0 was developed by Stefan Kurtz, Adam Phillippy, Arthur L Delcher, Michael Smoot, Martin Shumway, Corina Antonescu and Steven L Salzberg - most of whom are at The Institute for Genomic Research in Maryland, USA. POSIX OS required.<br /> <a href="http://www.novocraft.com/index.html" target="_blank">Novocraft</a> - Tools for reference alignment of paired-end and single-end Illumina reads. Uses a Needleman-Wunsch algorithm. Can support Bis-Seq. Commercial. Available free for evaluation, educational use and for use on open not-for-profit projects. Requires Linux or Mac OS X.<br /> <a href="http://pass.cribi.unipd.it/cgi-bin/pass.pl" target="_blank">PASS</a> - It supports Illumina, SOLiD and Roche-FLX data formats and allows the user to modulate very finely the sensitivity of the alignments. Spaced seed intial filter, then NW dynamic algorithm to a SW(like) local alignment. Authors are from CRIBI in Italy. Win/Linux.<br /> <a href="http://rulai.cshl.edu/rmap/" target="_blank">RMAP</a> - Assembles 20 - 64 bp Illumina reads to a FASTA reference genome. By Andrew D. Smith and Zhenyu Xuan at CSHL. (published in BMC Bioinformatics). POSIX OS required.<br /> <a href="http://biogibbs.stanford.edu/%7Ejiangh/SeqMap/" target="_blank">SeqMap</a> - Supports up to 5 or more bp mismatches/INDELs. Highly tunable. Written by Hui Jiang from the Wong lab at Stanford. Builds available for most OS's.<br /> <a href="http://compbio.cs.toronto.edu/shrimp/" target="_blank">SHRiMP</a> - Assembles to a reference sequence. Developed with Applied Biosystem's colourspace genomic representation in mind. Authors are Michael Brudno and Stephen Rumble at the University of Toronto. POSIX.<br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/slider" target="_blank"><span style="text-decoration: underline;">Slider</span></a>- An application for the Illumina Sequence Analyzer output that uses the probability files instead of the sequence files as an input for alignment to a reference sequence or a set of reference sequences. Authors are from BCGSC. Paper is <a href="http://seqanswers.com/forums/showthread.php?t=740" target="_blank">here</a>.<br /> <a href="http://soap.genomics.org.cn/" target="_blank">SOAP</a> - SOAP (Short Oligonucleotide Alignment Program). A program for efficient gapped and ungapped alignment of short oligonucleotides onto reference sequences. The updated version uses a BWT. Can call SNPs and INDELs. Author is Ruiqiang Li at the Beijing Genomics Institute. C++, POSIX.<br /> <a href="http://www.sanger.ac.uk/Software/analysis/SSAHA/" target="_blank">SSAHA</a> - SSAHA (Sequence Search and Alignment by Hashing Algorithm) is a tool for rapidly finding near exact matches in DNA or protein databases using a hash table. Developed at the Sanger Centre by Zemin Ning, Anthony Cox and James Mullikin. C++ for Linux/Alpha.<br /> <a href="http://socs.biology.gatech.edu/" target="_blank">SOCS</a> - Aligns SOLiD data. SOCS is built on an iterative variation of the Rabin-Karp string search algorithm, which uses hashing to reduce the set of possible matches, drastically increasing search speed. Authors are Ondov B, Varadarajan A, Passalacqua KD and Bergman NH.<br /> <a href="http://bibiserv.techfak.uni-bielefeld.de/swift/welcome.html" target="_blank">SWIFT</a> - The SWIFT suit is a software collection for fast index-based sequence comparison. It contains: SWIFT &mdash; fast local alignment search, guaranteeing to find epsilon-matches between two sequences. SWIFT BALSAM &mdash; a very fast program to find semiglobal non-gapped alignments based on k-mer seeds. Authors are Kim Rasmussen (SWIFT) and Wolfgang Gerlach (SWIFT BALSAM)<br /> <a href="http://synasite.mgrc.com.my:8080/sxog/NewSXOligoSearch.php" target="_blank">SXOligoSearch</a> - SXOligoSearch is a commercial platform offered by the Malaysian based <a href="http://www.synamatix.com/" target="_blank">Synamatix</a>. Will align Illumina reads against a range of Refseq RNA or NCBI genome builds for a number of organisms. Web Portal. OS independent.<br /> <a href="http://www.vmatch.de/" target="_blank">Vmatch</a> - A versatile software tool for efficiently solving large scale sequence matching tasks. Vmatch subsumes the software tool REPuter, but is much more general, with a very flexible user interface, and improved space and time requirements. Essentially a large string matching toolbox. POSIX.<br /> <a href="http://www.bioinformaticssolutions.com/products/zoom/index.php" target="_blank">Zoom</a> - ZOOM (Zillions Of Oligos Mapped) is designed to map millions of short reads, emerged by next-generation sequencing technology, back to the reference genomes, and carry out post-analysis. ZOOM is developed to be highly accurate, flexible, and user-friendly with speed being a critical priority. Commercial. Supports Illumina and SOLiD data.<br />NCGR uses GMAP (<a href="http://www.gene.com/share/gmap/" target="_blank">http://www.gene.com/share/gmap/</a>) to alignment Solexa reads. GMAP is free, though.<br />Exonerate (<a href="http://www.ebi.ac.uk/%7Eguy/exonerate/" target="_blank">http://www.ebi.ac.uk/~guy/exonerate/</a>)<br /> MUMmer (<a href="http://mummer.sourceforge.net/" target="_blank">http://mummer.sourceforge.net/</a>)<br /> The mapping short reads called gnumap (<a href="http://dna.cs.byu.edu/gnumap/" target="_blank">http://dna.cs.byu.edu/gnumap/</a>) made to increase the accuracy with duplicate matches. Open source, creates viewable output (with Affy's Integrated Genome Browser), and produces results very similar to novocraft's.<br /><a href="http://socs.biology.gatech.edu/" target="_blank">SOCS</a> (short oligonucleotides in color space)<br />BFAST <a href="https://secure.genome.ucla.edu/index.php/BFAST" target="_blank">https://secure.genome.ucla.edu/index.php/BFAST</a></p><p><br /> <strong><em>De novo</em> Align/Assemble</strong><br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/abyss" target="_blank">ABySS</a> - Assembly By Short Sequences. ABySS is a de novo sequence assembler that is designed for very short reads. The single-processor version is useful for assembling genomes up to 40-50 Mbases in size. The parallel version is implemented using MPI and is capable of assembling larger genomes. By Simpson JT and others at the Canada's Michael Smith Genome Sciences Centre. C++ as source. <br /> <a href="http://www.broad.mit.edu/science/programs/genome-biology/computational-rd/computational-research-and-development" target="_blank">ALLPATHS</a> - ALLPATHS: De novo assembly of whole-genome shotgun microreads. ALLPATHS is a whole genome shotgun assembler that can generate high quality assemblies from short reads. Assemblies are presented in a graph form that retains ambiguities, such as those arising from polymorphism, thereby providing information that has been absent from previous genome assemblies. Broad Institute.<br /> <a href="http://www.genomic.ch/edena.php" target="_blank">Edena</a> - Edena (Exact DE Novo Assembler) is an assembler dedicated to process the millions of very short reads produced by the Illumina Genome Analyzer. Edena is based on the traditional overlap layout paradigm. By D. Hernandez, P. Fran&ccedil;ois, L. Farinelli, M. Osteras, and J. Schrenzel. Linux/Win.<br /> <a href="http://euler-assembler.ucsd.edu/portal/" target="_blank">EULER-SR</a> - Short read <em>de novo</em> assembly. By Mark J. Chaisson and Pavel A. Pevzner from UCSD (published in Genome Research). Uses a de Bruijn graph approach.<br /> <a href="http://chevreux.org/projects_mira.html" target="_blank">MIRA2</a> - MIRA (Mimicking Intelligent Read Assembly) is able to perform true hybrid de-novo assemblies using reads gathered through 454 sequencing technology (GS20 or GS FLX). Compatible with 454, Solexa and Sanger data. Linux OS required.<br /> <a href="http://www.seqan.de/projects/consensus.html" target="_blank">SEQAN</a> - A Consistency-based Consensus Algorithm for De Novo and Reference-guided Sequence Assembly of Short Reads. By Tobias Rausch and others. C++, Linux/Win.<br /> <a href="http://sharcgs.molgen.mpg.de/" target="_blank">SHARCGS</a> - De novo assembly of short reads. Authors are Dohm JC, Lottaz C, Borodina T and Himmelbauer H. from the Max-Planck-Institute for Molecular Genetics.<br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/ssake" target="_blank">SSAKE</a> - The Short Sequence Assembly by K-mer search and 3' read Extension (SSAKE) is a genomics application for aggressively assembling millions of short nucleotide sequences by progressively searching for perfect 3'-most k-mers using a DNA prefix tree. Authors are Ren&eacute; Warren, Granger Sutton, Steven Jones and Robert Holt from the Canada's Michael Smith Genome Sciences Centre. Perl/Linux.<br /> <a href="http://soap.genomics.org.cn/" target="_blank">SOAPdenovo</a> - Part of the SOAP suite. See above. <br /> <a href="https://sourceforge.net/projects/vcake" target="_blank">VCAKE</a> - De novo assembly of short reads with robust error correction. An improvement on early versions of SSAKE.<br /> <a href="http://www.ebi.ac.uk/%7Ezerbino/velvet/" target="_blank">Velvet</a> - Velvet is a de novo genomic assembler specially designed for short read sequencing technologies, such as Solexa or 454. Need about 20-25X coverage and paired reads. Developed by Daniel Zerbino and Ewan Birney at the European Bioinformatics Institute (EMBL-EBI).<br />SOAP (<a href="http://soap.genomics.org.cn" target="_blank">http://soap.genomics.org.cn</a>) by Ruiqiang Li, as has been pointed by ECO.<br />Euler-SR (Euler-Short Reads Assembly, <a href="http://euler-assembler.ucsd.edu/portal/" target="_blank">http://euler-assembler.ucsd.edu/portal/</a>) by Mark J. Chaisson and Pavel A. Pevzner from UCSD. (published in Genome Research)<br />RMAP (A program for mapping Solexa reads, <a href="http://rulai.cshl.edu/rmap/" target="_blank">http://rulai.cshl.edu/rmap/</a>) by Andrew D. Smith and Zhenyu Xuan at CSHL. (published in BMC Bioinformatics)<br />Short read aligner called Bowtie (<a href="http://bowtie-bio.sourceforge.net/" target="_blank">http://bowtie-bio.sourceforge.net/</a>) designed for fast mapping of Illumina reads<br /> <br /> <strong>SNP/Indel Discovery</strong><br /> <a href="http://www.sanger.ac.uk/Software/analysis/ssahaSNP/" target="_blank">ssahaSNP</a> - ssahaSNP is a polymorphism detection tool. It detects homozygous SNPs and indels by aligning shotgun reads to the finished genome sequence. Highly repetitive elements are filtered out by ignoring those kmer words with high occurrence numbers. More tuned for ABI Sanger reads. Developers are Adam Spargo and Zemin Ning from the Sanger Centre. Compaq Alpha, Linux-64, Linux-32, Solaris and Mac<br /> <a href="http://bioinformatics.bc.edu/marthlab/PbShort" target="_blank">PolyBayesShort</a> - A re-incarnation of the PolyBayes SNP discovery tool developed by Gabor Marth at Washington University. This version is specifically optimized for the analysis of large numbers (millions) of high-throughput next-generation sequencer reads, aligned to whole chromosomes of model organism or mammalian genomes. Developers at Boston College. Linux-64 and Linux-32.<br /> <a href="http://bioinformatics.bc.edu/marthlab/PyroBayes" target="_blank">PyroBayes</a> - PyroBayes is a novel base caller for pyrosequences from the 454 Life Sciences sequencing machines. It was designed to assign more accurate base quality estimates to the 454 pyrosequences. Developers at Boston College.<br />Maq is also able to find SNPs with its own alignment. It has a graphical viewer, but again for its own alignment format.<br />SSAHA has been optimized for short-reads, too. But yes, SSAHASNP appears in your "SNP/INDEL discovery" category.<br /> <br /> <strong>Genome Annotation/Genome Browser/Alignment Viewer/Assembly Database</strong><br /> <a href="http://bioinformatics.bc.edu/marthlab/EagleView" target="_blank">EagleView</a> - An information-rich genome assembler viewer. EagleView can display a dozen different types of information including base quality and flowgram signal. Developers at Boston College.<br /> <a href="http://www.sanger.ac.uk/Software/analysis/lookseq/" target="_blank">LookSeq</a> - LookSeq is a web-based application for alignment visualization, browsing and analysis of genome sequence data. LookSeq supports multiple sequencing technologies, alignment sources, and viewing modes; low or high-depth read pileups; and easy visualization of putative single nucleotide and structural variation. From the Sanger Centre.<br /> <a href="http://evolution.sysu.edu.cn/mapview/" target="_blank">MapView</a> - MapView: visualization of short reads alignment on desktop computer. From the Evolutionary Genomics Lab at Sun-Yat Sen University, China. Linux.<br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/sam" target="_blank">SAM</a> - Sequence Assembly Manager. Whole Genome Assembly (WGA) Management and Visualization Tool. It provides a generic platform for manipulating, analyzing and viewing WGA data, regardless of input type. Developers are Rene Warren, Yaron Butterfield, Asim Siddiqui and Steven Jones at Canada's Michael Smith Genome Sciences Centre. MySQL backend and Perl-CGI web-based frontend/Linux. <br /> <a href="http://staden.sourceforge.net/" target="_blank">STADEN</a> - Includes GAP4. GAP5 once completed will handle next-gen sequencing data. A partially implemented test version is available <a href="https://sourceforge.net/project/show...kage_id=256957" target="_blank">here</a><br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/xmatchview" target="_blank">XMatchView</a> - A visual tool for analyzing cross_match alignments. Developed by Rene Warren and Steven Jones at Canada's Michael Smith Genome Sciences Centre. Python/Win or Linux.<br /> <br /> <strong>Counting e.g. CHiP-Seq, Bis-Seq, CNV-Seq</strong><br /> <a href="http://epigenomics.mcdb.ucla.edu/BS-Seq/download.html" target="_blank">BS-Seq</a> - The source code and data for the "Shotgun Bisulphite Sequencing of the Arabidopsis Genome Reveals DNA Methylation Patterning" Nature paper by <a href="http://www.ncbi.nlm.nih.gov/sites/entrez?holding=&amp;db=pubmed&amp;cmd=search&amp;term=Shotgun%20Bisulphite%20Sequencing" target="_blank">Cokus et al.</a> (Steve Jacobsen's lab at UCLA). POSIX.<br /> <a href="http://woldlab.caltech.edu/chipseq/" target="_blank">CHiPSeq</a> - Program used by Johnson et al. (2007) in their Science publication<br /> <a href="http://tiger.dbs.nus.edu.sg/cnv-seq/" target="_blank">CNV-Seq</a> - CNV-seq, a new method to detect copy number variation using high-throughput sequencing. Chao Xie and Martti T Tammi at the National University of Singapore. Perl/R.<br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/findpeaks" target="_blank">FindPeaks</a> - perform analysis of ChIP-Seq experiments. It uses a naive algorithm for identifying regions of high coverage, which represent Chromatin Immunoprecipitation enrichment of sequence fragments, indicating the location of a bound protein of interest. Original algorithm by Matthew Bainbridge, in collaboration with Gordon Robertson. Current code and implementation by Anthony Fejes. Authors are from the Canada's Michael Smith Genome Sciences Centre. JAVA/OS independent. Latest versions available as part of the <a href="http://vancouvershortr.sourceforge.net/" target="_blank">Vancouver Short Read Analysis Package</a><br /> <a href="http://liulab.dfci.harvard.edu/MACS/" target="_blank">MACS</a> - Model-based Analysis for ChIP-Seq. MACS empirically models the length of the sequenced ChIP fragments, which tends to be shorter than sonication or library construction size estimates, and uses it to improve the spatial resolution of predicted binding sites. MACS also uses a dynamic Poisson distribution to effectively capture local biases in the genome sequence, allowing for more sensitive and robust prediction. Written by Yong Zhang and Tao Liu from Xiaole Shirley Liu's Lab. <br /> <a href="http://www.gersteinlab.org/proj/PeakSeq/" target="_blank">PeakSeq</a> - PeakSeq: Systematic Scoring of ChIP-Seq Experiments Relative to Controls. a two-pass approach for scoring ChIP-Seq data relative to controls. The first pass identifies putative binding sites and compensates for variation in the mappability of sequences across the genome. The second pass filters out sites that are not significantly enriched compared to the normalized input DNA and computes a precise enrichment and significance. By Rozowsky J et al. C/Perl.<br /> <a href="http://mendel.stanford.edu/sidowlab/downloads/quest/" target="_blank">QuEST</a> - Quantitative Enrichment of Sequence Tags. Sidow and Myers Labs at Stanford. From the 2008 publication <a href="http://www.ncbi.nlm.nih.gov/pubmed/18711362" target="_blank">Genome-wide analysis of transcription factor binding sites based on ChIP-Seq data</a>. (C++)<br /> <a href="http://dir.nhlbi.nih.gov/papers/lmi/epigenomes/sissrs/" target="_blank">SISSRs</a> - Site Identification from Short Sequence Reads. BED file input. Raja Jothi @ NIH. Perl.<br />SeqMap (<a href="http://biogibbs.stanford.edu/%7Ejiangh/SeqMap/" target="_blank">http://biogibbs.stanford.edu/~jiangh/SeqMap/</a>) - work like ELand, can do 3 or more bp mismatches and also insdel<br />ChIPSeq analysis is:&nbsp; <a href="http://dir.nhlbi.nih.gov/papers/lmi/epigenomes/sissrs/" target="_blank">http://dir.nhlbi.nih.gov/papers/lmi/epigenomes/sissrs/</a></p><p>See also <a href="http://seqanswers.com/forums/showthread.php?t=742" target="_blank">this thread</a> for ChIP-Seq, until I get time to update this list.<br /> <br /> <strong>Alternate Base Calling</strong><br /> <a href="http://svitsrv25.epfl.ch/R-doc/library/Rolexa/html/00Index.html" target="_blank">Rolexa</a> - R-based framework for base calling of Solexa data. Project <a href="http://www.biomedcentral.com/1471-2105/9/431" target="_blank">publication</a><br /> <a href="http://hannonlab.cshl.edu/Alta-Cyclic/main.html" target="_blank">Alta-cyclic</a> - "a novel Illumina Genome-Analyzer (Solexa) base caller"<br /> <br /> <strong>Transcriptomics</strong><br /> <a href="http://woldlab.caltech.edu/rnaseq/" target="_blank">ERANGE</a> - Mapping and Quantifying Mammalian Transcriptomes by RNA-Seq. Supports Bowtie, BLAT and ELAND. From the Wold lab.<br /> <a href="http://www.genoscope.cns.fr/externe/gmorse/" target="_blank">G-Mo.R-Se</a> - G-Mo.R-Se is a method aimed at using RNA-Seq short reads to build de novo gene models. First, candidate exons are built directly from the positions of the reads mapped on the genome (without any ab initio assembly of the reads), and all the possible splice junctions between those exons are tested against unmapped reads. From CNS in France.<br /> <a href="http://evolution.sysu.edu.cn/english/software/mapnext.htm" target="_blank">MapNext</a> - MapNext: A software tool for spliced and unspliced alignments and SNP detection of short sequence reads. From the Evolutionary Genomics Lab at Sun-Yat Sen University, China.<br /> <a href="http://www.fml.tuebingen.mpg.de/raetsch/suppl/qpalma" target="_blank">QPalma</a> - Optimal Spliced Alignments of Short Sequence Reads. Authors are Fabio De Bona, Stephan Ossowski, Korbinian Schneeberger, and Gunnar R&auml;tsch. A paper is <a href="http://www.fml.tuebingen.mpg.de/raetsch/suppl/qpalma/qpalma-final.pdf" target="_blank">available</a>.<br /> <a href="http://biogibbs.stanford.edu/%7Ejiangh/rsat/" target="_blank">RSAT</a> - RSAT: RNA-Seq Analysis Tools. RNASAT is developed and maintained by Hui Jiang at Stanford University.<br /> <a href="http://tophat.cbcb.umd.edu/" target="_blank">TopHat</a> - TopHat is a fast splice junction mapper for RNA-Seq reads. It aligns RNA-Seq reads to mammalian-sized genomes using the ultra high-throughput short read aligner Bowtie, and then analyzes the mapping results to identify splice junctions between exons. TopHat is a collaborative effort between the University of Maryland and the University of California, Berkeley<br />NGS-Trex: Next Generation Sequencing Transcriptome profile explorer http://www.biomedcentral.com/1471-2105/14/S7/S10</p><p>Reference</p><p>Illumina has a software list: <a href="http://www.illumina.com/pagesnrn.ilmn?ID=245" target="_blank">http://www.illumina.com/pagesnrn.ilmn?ID=245</a>.</p><p>Some softwares in his blog (<a href="http://www.fejes.ca/labels/DNA.html" target="_blank">http://www.fejes.ca/labels/DNA.html</a>)</p><p><a href="http://seqanswers.com/wiki/Software" target="_blank">http://seqanswers.com/wiki/Software</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</guid>
	<pubDate>Sat, 07 Dec 2024 22:32:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</link>
	<title><![CDATA[A Step-by-Step Guide to Running BLAST Offline]]></title>
	<description><![CDATA[<p>BLAST (Basic Local Alignment Search Tool) is a powerful algorithm used to compare nucleotide or protein sequences to sequence databases, identifying regions of similarity. Running BLAST offline provides more control, ensures data security, and allows customization for specific research needs. Here&rsquo;s a detailed guide to set up and run BLAST locally on your system.</p><hr><h3>Step 1: <strong>Install BLAST</strong></h3><ol>
<li>
<p><strong>Download BLAST</strong>:</p>
<ul>
<li>Visit the <a href="https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/">NCBI BLAST+ download page</a> to download the appropriate version for your operating system (Windows, macOS, or Linux).</li>
</ul>
</li>
<li>
<p><strong>Install BLAST</strong>:</p>
<ul>
<li>Extract the downloaded archive. For Linux/Mac, use:
<pre><code>tar -xvzf ncbi-blast-*.tar.gz
cd ncbi-blast-*
</code></pre>
</li>
<li>Add the BLAST binary folder to your system PATH for easier access:
<pre><code>export PATH=$PATH:/path/to/ncbi-blast-*/bin
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Verify Installation</strong>:<br /> Run the following command to ensure BLAST is installed correctly:</p>
<pre><code>blastn -version
</code></pre>
</li>
</ol><hr><h3>Step 2: <strong>Prepare a Local Database</strong></h3><p>To run BLAST offline, you&rsquo;ll need a sequence database.</p><ol>
<li>
<p><strong>Download a Pre-Built Database (Optional)</strong>:</p>
<ul>
<li>NCBI provides ready-to-use databases such as <code>nt</code>, <code>nr</code>, and <code>Swiss-Prot</code>. Use the <code>update_blastdb.pl</code> script (bundled with BLAST) to download these:
<pre><code>update_blastdb.pl --decompress nt
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Create a Custom Database</strong>:<br /> If you have specific sequences to use as a database:</p>
<ul>
<li>Prepare a FASTA file containing the sequences.</li>
<li>Use <code>makeblastdb</code> to create a database:
<pre><code>makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
</code></pre>
Replace <code>[nucl|prot]</code> with <code>nucl</code> for nucleotide sequences or <code>prot</code> for protein sequences.</li>
</ul>
</li>
</ol><hr><h3>Step 3: <strong>Prepare the Query Sequence</strong></h3><ul>
<li>Save your query sequence(s) in FASTA format.</li>
<li>Ensure the file is properly formatted, with a header line starting with <code>&gt;</code> followed by the sequence name, and the sequence on subsequent lines.</li>
</ul><p>Example:</p><pre><code>&gt;query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA
</code></pre><hr><h3>Step 4: <strong>Run BLAST</strong></h3><ol>
<li>
<p><strong>Choose the Appropriate BLAST Tool</strong>:<br /> Depending on your data type:</p>
<ul>
<li><strong>blastn</strong>: For nucleotide-nucleotide searches.</li>
<li><strong>blastp</strong>: For protein-protein searches.</li>
<li><strong>blastx</strong>: Translates nucleotide sequences into proteins and compares them to a protein database.</li>
<li><strong>tblastn</strong>: Compares protein sequences to a nucleotide database.</li>
<li><strong>tblastx</strong>: Translates both nucleotide query and database sequences.</li>
</ul>
</li>
<li>
<p><strong>Run the Command</strong>:<br /> Example command for <code>blastn</code>:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
</code></pre>
<p><strong>Explanation of Parameters</strong>:</p>
<ul>
<li><code>-query</code>: Specifies the query file.</li>
<li><code>-db</code>: Points to the local database.</li>
<li><code>-out</code>: Output file name.</li>
<li><code>-outfmt</code>: Output format (e.g., 6 for tabular format).</li>
<li><code>-evalue</code>: E-value cutoff for significance.</li>
</ul>
</li>
</ol><hr><h3>Step 5: <strong>Interpret Results</strong></h3><ol>
<li>
<p><strong>Output Formats</strong>:</p>
<ul>
<li><strong>Default (outfmt 0)</strong>: Human-readable format.</li>
<li><strong>Tabular (outfmt 6)</strong>: Includes fields like query ID, subject ID, percent identity, alignment length, etc.</li>
</ul>
</li>
<li>
<p><strong>Analyze Results</strong>:<br /> Use tools like <code>grep</code>, Python, or R to parse and filter results for downstream analysis.</p>
</li>
</ol><hr><h3>Step 6: <strong>Optimize Performance</strong></h3><p>For large datasets, BLAST can be resource-intensive. To improve performance:</p><ol>
<li>
<p><strong>Multithreading</strong>:<br /> Use the <code>-num_threads</code> option to leverage multiple CPU cores:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
</code></pre>
</li>
<li>
<p><strong>Database Subsetting</strong>:<br /> Split large databases into smaller chunks for faster searches.</p>
</li>
<li>
<p><strong>Adjust Parameters</strong>:</p>
<ul>
<li>Lower the <code>-evalue</code> threshold for stricter matches.</li>
<li>Use <code>-max_target_seqs</code> to limit the number of results per query.</li>
</ul>
</li>
</ol><hr><h3>Step 7: <strong>Update Databases (Optional)</strong></h3><p>If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:</p><pre><code>update_blastdb.pl --decompress nt
</code></pre><hr><h3>Conclusion</h3><p>Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.</p><p>For advanced use cases, explore BLAST&rsquo;s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/11603/ncbi-webinar</guid>
	<pubDate>Sun, 08 Jun 2014 02:47:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/11603/ncbi-webinar</link>
	<title><![CDATA[NCBI Webinar]]></title>
	<description><![CDATA[<p>In less than two weeks, NCBI will offer a webinar entitled "Introducing 3 NCBI Resources to Navigate Testing for Disease Linked Variants: MedGen, GTR and ClinVar". This webinar will delve into the lifecycle of genetic testing and teach attendees how to navigate the NIH Genetic Testing Registry, ClinVar, and MedGen resources. These resources can be used to prepare for clinical cases, access detailed information about orderable genetic tests, interpret test results, and more.</p><p>More at https://attendee.gotowebinar.com/register/8452228815737989634</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12111/internship-program-with-arraygen-technolgies</guid>
  <pubDate>Sun, 22 Jun 2014 23:18:31 -0500</pubDate>
  <link></link>
  <title><![CDATA[Internship program with ArrayGen Technolgies]]></title>
  <description><![CDATA[
<p>Internship Program for Bioinformatics / Biotechnology Professionals Currently we offer positions to outstanding students interested in Next Generation Sequencing (NGS) data analysis. Applications are accepted throughout the year. Accepted students will be listed on web with their schedules. Accepted students can attend our future workshops and trainings freely at the specified venue.</p>

<p>Interested candidates may email their resume along with a cover letter to careers@arraygen.com</p>

<p>Official website: http://www.arraygen.com/</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12566/jrf-at-national-research-centre-on-plant-biotechnology</guid>
  <pubDate>Fri, 04 Jul 2014 13:36:02 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF at NATIONAL RESEARCH CENTRE ON PLANT BIOTECHNOLOGY]]></title>
  <description><![CDATA[
<p>NATIONAL RESEARCH CENTRE ON PLANT BIOTECHNOLOGY</p>

<p>New Delhi-110012</p>

<p>Walk in interview</p>

<p>Eligible candidates may appear for Walk-in interview for the temporary positions of JRF/SRF/ RA, in ICAR, DBT funded research projects. Positions are purely temporary in nature and are co-terminus with the projects. The initial appointment will be for maximum one year, which can be extended on the basis of assessment of the candidate performance and need in the project work (PI-Dr. N. K. Singh, National Professor).</p>

<p>Name of the</p>

<p>PI (Project)<br />	</p>

<p>Name of</p>

<p>Position<br />	</p>

<p>Number of</p>

<p>positions<br />	</p>

<p>Emoluments</p>

<p>Fixed per</p>

<p>month (Rs.)<br />	</p>

<p>Essential</p>

<p>Qualifications</p>

<p>DBT-“Physical Mapping and Sample sequencing of Wheat Chromosome 2A- International Wheat Genome Sequencing Consortium (India)”.</p>

<p>(Up to Nov,2014)</p>

<p>DBT- Identification and functional analysis of genes related to yield and biotic stresses (Up to Oct,2014)</p>

<p>NPTC-Central Facility<br />	</p>

<p>RA (Master)</p>

<p>JRF/SRF</p>

<p>Research Associate: One</p>

<p>Essential: MCA or M. Tech. (Bioinformatics and computer Science with 2 years experience in Database Management with</p>

<p>MySQL, Linux)</p>

<p>Desirable: Proficiency in handling of large biological databases</p>

<p>Age limit: Max. Age 35 years (Age of relaxation of 5 years for SC/ST&amp; woman. and 3 years for OBC). The interview will be held on 08 July, 2014 at 11 am at room no. 39, NRCPB, LBS Building, Pusa Campus, New Delhi-110012. The candidates must bring original certificates and four copies of biodata, and recent passport size photograph. No TA/DA would be given for the appearance in interview. Only the candidates having essential qualifications would be entertained for the interviews.</p>

<p>Advertisement:</p>

<p>www.nrcpb.org/sites/default/files/news%20paper%20advirtisment..docx</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12988/guest-lecturer-molecular-biology-bioinformatics</guid>
  <pubDate>Wed, 23 Jul 2014 13:34:41 -0500</pubDate>
  <link></link>
  <title><![CDATA[Guest Lecturer - Molecular Biology &amp; Bioinformatics]]></title>
  <description><![CDATA[
<p>Adv. No. F.TU/ACA/GT-APP/01/14 Date: 07.07.2014</p>

<p>Faculty of Science</p>

<p>Essential Qualifications:</p>

<p>(i) Good academic record having at least 55% marks (or an equivalent grade in a point scale wherever grading system is followed) at the Master’s Degree level in a relevant subject, from an Indian University, or an equivalent degree from an accredited foreign University.</p>

<p>(II) Besides fulfilling the above qualifications, the candidates must have cleared the National Eligibility Test (NET) conducted by the UGC, CSIR or similar test accredited by the UGC like SLET/SET.</p>

<p>(III) Notwithstanding anything contained in sub-clauses (i) and (ii) of clause 4.4.1 of UGC regulations 2010, candidates, who are, or have been awarded a Ph.D. Degree in accordance with the University Grants Commission (Minimum Standards and Procedure for Award of Ph.D. Degree) Regulations, 2009, shall be exempted from the requirement of the minimum eligibility condition of NET/ SLET/ SET for engagement of guest Teacher.</p>

<p>(IV) NET/ SLET/ SET shall also not be required for such Master’s Degree Programmes in discipline for which NET/ SLET/ SET is not conducted.</p>

<p>Application form along with detailed instructions can be downloaded from Tripura University website: www.tripurauniv.in. The duly filled in application forms complete in all respects may be sent so as to reach the Office of the Deputy Registrar Academic Branch, Tripura University, Suryamaninagar - 799022, Tripura on or before 31st July, 2014. The Candidates who responded against advertisement No. TU.REG/N-Advt./02/10 dated 20.02.2014 need not apply again.</p>

<p>For more info visit: http://www.tripurauniv.in/images/universitymedia/EmploymentNotification/Guest%20Teacher%20Advt.%20website_09072014.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/14215/the-8000-years-old-tibetian-gene-mutation</guid>
	<pubDate>Wed, 20 Aug 2014 21:57:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/14215/the-8000-years-old-tibetian-gene-mutation</link>
	<title><![CDATA[The 8000 years old Tibetian gene mutation !!!]]></title>
	<description><![CDATA[<p>A new study has provided insight into how gene mutation around 8,000 years ago helped Tibetans' to survive in the thin air on the Tibetan Plateau, where an average elevation is of 14,800 feet.<br /><br />A study led by University of Utah scientists is the first to find a genetic cause for the adaptation, a single DNA base pair change that dates back 8,000 years and demonstrate how it contributes to the Tibetans' ability to live in low oxygen conditions.</p><p>About 8,000 years ago, the gene EGLN1 changed by a single DNA base pair. Today, a relatively short time later on the scale of human history, 88 percent of Tibetans have the genetic variation, and it was virtually absent from closely related lowland Asians. The findings indicate the genetic variation endows its carriers with an advantage.<br /><br />In those without the adaptation, low oxygen caused their blood to become thick with oxygen-carrying red blood cells, an attempt to feed starved tissues, which could cause long-term complications such as heart failure. The researchers found that the newly identified genetic variation protected Tibetans by decreasing the over-response to low oxygen.</p><p>Reference: http://www.nature.com/nature/journal/v512/n7513/abs/nature13408.html</p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>