If you have any questions or comments, post them on one of the trackers on BRIG’s SourceForge page:http://sourceforge.net/tracker/?group_id=328245.

Features:

• Images show similarity between a central reference sequence and other sequences as concentric rings.
• BRIG will perform all BLAST comparisons and file parsing automatically via a simple GUI.
• Contig boundaries and read coverage can be displayed for draft genomes; customized graphs and annotations can be displayed.
• Using a user-defined set of genes as input, BRIG can display gene presence, absence, truncation or sequence variation in a set of complete genomes, draft genomes or even raw, unassembled sequence data.
• BRIG also accepts SAM-formatted read-mapping files enabling genomic regions present in unassembled sequence data from multiple samples to be compared simultaneously

Address of the bookmark: http://brig.sourceforge.net/

The goal of this tutorial is to run you through a demonstration of the command line, which you may not have seen or used much before.

All of the commands below can copy/pasted.

sudo apt-get update && sudo apt-get -y install python ncbi-blast+

wget ftp://ftp.ncbi.nih.gov/refseq/B_taurus/mRNA_Prot/cow.1.protein.faa.gz
wget ftp://ftp.ncbi.nih.gov/refseq/H_sapiens/mRNA_Prot/human.1.protein.faa.gz

gunzip *gz
ls

head cow.1.protein.faa
head human.1.protein.faa

grep -c '^>' cow.1.protein.faa
grep -c '^>' human.1.protein.faa

head -6 cow.1.protein.faa > cow.small.faa

makeblastdb -in human.1.protein.faa -dbtype prot
ls

blastp -query cow.small.faa -db human.1.protein.faa

    blastp -query cow.small.faa -db human.1.protein.faa -out cow_vs_human_blast_results.txt
ls

less cow_vs_human_blast_results.txt

blastp -help

blastp -help | less

blastp \
-query cow.small.faa \
-db human.1.protein.faa \
-out cow_vs_human_blast_results.tab \
-evalue 1e-5 \
-outfmt 7

head -199 cow.1.protein.faa > cow.medium.faa

grep -c '^>' cow.medium.faa

blastp \
-query cow.medium.faa \
-db human.1.protein.faa \
-out cow_vs_human_blast_results.tab \
-evalue 1e-5 \
-outfmt 6 \
-max_target_seqs 1

Here is a list of what is changing:

1. All databases at the root level will be dbV5.
2. The dbV5 file naming,  “_v5” will be removed. Databases with  no “_vX” descriptor will be dbV5.
3. dbV4 tarballs will be renamed with "_v4", files included in tarball will not be renamed.
4. dbV4 databases will be moved to a v4 subdirectory.
5. As of 1/13/20 the Cloud directory will be frozen with no more new entries.
6. The will be no more updates to dbV4 databases.
7. The FASTA directory will contain nr, nt, swissprot, and pdbaa files.

If you have any questions or concerns, please contact blast-help@ncbi.nlm.nih.gov

1. ElasticBLAST can handle much LARGER queries! 

ElasticBLAST can search query sets that have hundreds to millions of sequences and against BLAST databases of all sizes.

2. ElasticBLAST is FASTER

ElasticBLAST distributes your searches across multiple cloud instances to process them simultaneously. The ability to scale resources in this way allows you to process large numbers of queries in a shorter time than you could with BLAST+.

3. ElasticBLAST is EASY to run on the cloud

ElasticBLAST is easy to set up using our step-by-step instructions (Amazon Web Services (AWS), Google Cloud Platform (GCP)) and allows you to leverage the power of the cloud. Once configured, it manages the software and database installation, handles partitioning of the BLAST workload among the various instances, and deallocates cloud resources when the searches are done.

ElasticBLAST also selects the instance (i.e., machine) type for you based on database size. Of course, you can also choose the instance type manually if you prefer. 

Address of the bookmark: https://blast.ncbi.nlm.nih.gov/doc/elastic-blast/

http://elements.eaglegenomics.com/

A fairly complete on-line guide to BLAST searching can be found at the NCBI BLAST Help Manual. For a theoretical overview of BLAST, see the NCBI BLAST Course. Additional information can be found in the BLAST 2.0 Release Notes

Supported and Suggested Values for Gap Open and Extension in BLASTP, BLASTX, TBLASTN, and TBLASTX

Address of the bookmark: https://www.arabidopsis.org/Blast/BLASToptions.jsp

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!