<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/42415?offset=50</link>
	<atom:link href="https://bioinformaticsonline.com/related/42415?offset=50" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34571/mugsy-multiple-whole-genome-alignment-tool</guid>
	<pubDate>Fri, 08 Dec 2017 17:41:14 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34571/mugsy-multiple-whole-genome-alignment-tool</link>
	<title><![CDATA[Mugsy: multiple whole genome alignment tool]]></title>
	<description><![CDATA[<p><span>Mugsy is a multiple whole genome aligner. Mugsy uses Nucmer for pairwise alignment, a custom graph based segmentation procedure for identifying collinear regions, and the segment-based progressive multiple alignment strategy from Seqan::TCoffee. Mugsy accepts draft genomes in the form of multi-FASTA files and does not require a reference genome.</span></p>
<p>To cite Mugsy, use:</p>
<p>Angiuoli SV and Salzberg SL.&nbsp;<a href="http://bioinformatics.oxfordjournals.org/content/27/3/334">Mugsy: Fast multiple alignment of closely related whole genomes.</a><em>Bioinformatics</em>&nbsp;2011 27(3):334-4</p><p>Address of the bookmark: <a href="http://mugsy.sourceforge.net/" rel="nofollow">http://mugsy.sourceforge.net/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34867/magic-blast-a-tool-for-mapping-large-next-generation-rna-or-dna-sequencing-runs-against-a-whole-genome-or-transcriptome</guid>
	<pubDate>Tue, 26 Dec 2017 22:23:39 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34867/magic-blast-a-tool-for-mapping-large-next-generation-rna-or-dna-sequencing-runs-against-a-whole-genome-or-transcriptome</link>
	<title><![CDATA[Magic-BLAST: a tool for mapping large next-generation RNA or DNA sequencing runs against a whole genome or transcriptome.]]></title>
	<description><![CDATA[<p>Magic-BLAST is a tool for mapping large next-generation RNA or DNA sequencing runs against a whole genome or transcriptome. Each alignment optimizes a composite score, taking into account simultaneously the two reads of a pair, and in case of RNA-seq, locating the candidate introns and adding up the score of all exons. This is very different from other versions of BLAST, where each exon is scored as a separate hit and read-pairing is ignored.</p>
<p>Magic-BLAST incorporates within the NCBI BLAST code framework ideas developed in the NCBI Magic pipeline, in particular hit extensions by local walk and jump&nbsp;<a href="http://www.ncbi.nlm.nih.gov/pubmed/26109056">(http://www.ncbi.nlm.nih.gov/pubmed/26109056)</a>, and recursive clipping of mismatches near the edges of the reads, which avoids accumulating artefactual mismatches near splice sites and is needed to distinguish short indels from substitutions near the edges.</p><p>Address of the bookmark: <a href="https://ncbi.github.io/magicblast/" rel="nofollow">https://ncbi.github.io/magicblast/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35429/list-of-visualization-tools-for-genome-alignments</guid>
	<pubDate>Fri, 02 Feb 2018 13:25:33 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35429/list-of-visualization-tools-for-genome-alignments</link>
	<title><![CDATA[List of visualization tools for genome alignments]]></title>
	<description><![CDATA[<p><span>Genome</span><span>&nbsp;browsers are useful not only for showing final results but also for improving analysis protocols, testing data quality, and generating result drafts. Its integration in analysis pipelines allows the optimization of parameters, which leads to better results. But sometime, we need publication ready figure of genomes. Following are the list of genome alignment visualization tools, which could be useful for analysis and&nbsp;interpretation of results:</span></p><p>ABySS Explorer</p><p>Interactive Java application that uses a novel graph-based representation to display a sequence assembly and associated metadata</p><p>http://www.bcgsc.ca/platform/bioinfo/software/abyss-explorer</p><p>BamView</p><p>Genome browser and annotation tool that allows visualization of sequence features, next-generation sequencing (NGS) data and the results of analyses within the context of the sequence, and also its six-frame translation</p><p>http://www.sanger.ac.uk/resources/software/artemis/</p><p>DNannotator&nbsp;</p><p>Annotation web toolkit for regional genomic sequences</p><p>http://bioapp.psych.uic.edu/DNannotator.htm</p><p>JVM&nbsp;</p><p>Java Visual Mapping tool for NGS reads</p><p>http://www.springer.com/cda/content/document/cda_downloaddocument/9789401792448-c2.pdf?SGWID=0-0-45-1487072-p176815501</p><p>LookSeq&nbsp;</p><p>Web-based visualization of sequences derived from multiple sequencing technologies. Low- or high-depth read pileups and easy visualization of putative single nucleotide and structural variation</p><p>http://lookseq.sourceforge.net</p><p>MagicViewer&nbsp;</p><p>Visualization of short read alignment, identification of genetic variation and association with annotation information of a reference genome</p><p>http://bioinformatics.zj.cn/magicviewer/</p><p>MapView&nbsp;</p><p>Alignments of huge-scale single-end and pair-end short reads</p><p>http://omictools.com/mapview-s1367.html</p><p>MultiPipMaker</p><p>Computes alignments of similar regions in two DNA sequences. The resulting alignments are summarized with a &lsquo;percent identity plot&rsquo; (pip)</p><p>http://pipmaker.bx.psu.edu/pipmaker/</p><p>PileLineGUI&nbsp;</p><p>Handling genome position files in NGS studies</p><p>http://sing.ei.uvigo.es/pileline/pilelinegui.html</p><p>SAMtools tview&nbsp;</p><p>Simple and fast text alignment viewer; NGS compatible</p><p>http://www.htslib.org/</p><p>SEWAL</p><p>Uses a locality-sensitive hashing algorithm to enumerate all unique sequences in an entire Illumina sequencing run</p><p>http://www.sourceforge.net/projects/sewal</p><p>STAR&nbsp;</p><p>A web-based integrated solution to management and visualization of sequencing data</p><p>http://wanglab.ucsd.edu/star/browser</p><p>SVA&nbsp;</p><p>Software for annotating and visualizing sequenced human genomes</p><p>http://www.svaproject.org</p><p>Viewer (IGV)&nbsp;</p><p>Visualization of large heterogeneous datasets, providing a smooth and intuitive user experience at all levels of genome resolution</p><p>https://www.broadinstitute.org/igv/</p><p>ZOOM Lite&nbsp;</p><p>NGS data mapping and visualization software</p><p>http://bioinfor.com/zoom/lite/</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36218/g-compass-a-comparative-genome-browser</guid>
	<pubDate>Thu, 12 Apr 2018 10:00:27 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36218/g-compass-a-comparative-genome-browser</link>
	<title><![CDATA[G-compass: a comparative genome browser]]></title>
	<description><![CDATA[<p><span>G-compass (</span><a href="http://www.h-invitational.jp/g-compass/" target="_top">http://www.h-invitational.jp/g-compass/</a><span>) is a comparative genome browser. It visualizes evolutionarily conserved genomic regions between human and other 12 vertebrates based on original genome alignments pursuing higher coverage (1,2). Annotations of human genes/transcripts and their ortholog information were derived from&nbsp;</span><a href="http://www.h-invitational.jp/hinv/ahg-db/index.jsp" target="_top">H-InvDB</a><span>&nbsp;and its subdatabase&nbsp;</span><a href="http://www.h-invitational.jp/evola/" target="_top">Evola</a><span>, respectively. G-compass is available for free of charge. [&nbsp;</span><a href="http://www.h-invitational.jp/g-compass/cgi-bin/gc_main.cgi?species_1=Hg18&amp;species_2=pt2&amp;strand_1=%2B&amp;strand_2=%2B&amp;from_win=main&amp;gen_str=2&amp;chr_1=01&amp;chr_2=01&amp;st_1=103804298&amp;ed_1=104204297&amp;st_2=105235351&amp;ed_2=105635350" target="_top">Sample</a><span>&nbsp;]</span></p><p>Address of the bookmark: <a href="http://www.h-invitational.jp/g-compass/" rel="nofollow">http://www.h-invitational.jp/g-compass/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36635/circlator-automated-circularization-of-genome-assemblies-using-long-sequencing-reads</guid>
	<pubDate>Tue, 15 May 2018 09:42:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36635/circlator-automated-circularization-of-genome-assemblies-using-long-sequencing-reads</link>
	<title><![CDATA[Circlator: automated circularization of genome assemblies using long sequencing reads]]></title>
	<description><![CDATA[A tool to circularize genome assemblies. The algorithm and benchmarks are described in the Genome Biology manuscript. 

Citation: "Circlator: automated circularization of genome assemblies using long sequencing reads", Hunt et al, Genome Biology 2015 Dec 29;16(1):294. doi: 10.1186/s13059-015-0849-0. PMID: 26714481.<p>Address of the bookmark: <a href="http://sanger-pathogens.github.io/circlator/" rel="nofollow">http://sanger-pathogens.github.io/circlator/</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37840/long-read-assembly-workshop</guid>
	<pubDate>Thu, 04 Oct 2018 17:23:18 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37840/long-read-assembly-workshop</link>
	<title><![CDATA[Long read assembly workshop !]]></title>
	<description><![CDATA[<p>This is a tutorial for a workshop on long-read (PacBio) genome assembly.</p>
<p>It demonstrates how to use long PacBio sequencing reads to assemble a bacterial genome, and includes additional steps for circularising, trimming, finding plasmids, and correcting the assembly with short-read Illumina data.</p>
<p>&nbsp;Please comment if you know any other long read addembly tutorial.</p><p>Address of the bookmark: <a href="http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/" rel="nofollow">http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38041/synima-a-synteny-imaging-tool-for-annotated-genome-assemblies</guid>
	<pubDate>Tue, 30 Oct 2018 10:49:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38041/synima-a-synteny-imaging-tool-for-annotated-genome-assemblies</link>
	<title><![CDATA[Synima: a Synteny imaging tool for annotated genome assemblies]]></title>
	<description><![CDATA[<p><span>Synima written in Perl, which uses the graphical features of R. Synima takes orthologues computed from reciprocal best BLAST hits or OrthoMCL, and DAGchainer, and outputs an overview of genome-wide synteny in PDF. Each of these programs are included with the Synima package, and a pipeline for their use. Synima has a range of graphical parameters including size, colours, order, and labels, which are specified in a config file generated by the first run of Synima &ndash; and can be subsequently edited. Synima runs quickly on a command line to generate informative and publication quality figures. Synima is open source and freely available from&nbsp;</span><a href="https://github.com/rhysf/Synima" target="_blank">https://github.com/rhysf/Synima</a><span>&nbsp;under the MIT License.</span></p><p>Address of the bookmark: <a href="https://github.com/rhysf/Synima" rel="nofollow">https://github.com/rhysf/Synima</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>

</channel>
</rss>