<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/42707?offset=500</link>
	<atom:link href="https://bioinformaticsonline.com/related/42707?offset=500" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/9055/computational-biologist-scientist-strand-life-sciences</guid>
  <pubDate>Fri, 14 Mar 2014 11:36:56 -0500</pubDate>
  <link></link>
  <title><![CDATA[Computational Biologist Scientist @ Strand Life Sciences]]></title>
  <description><![CDATA[
<p>We are looking for a motivated application scientist to help evaluate, compare, and develop next generation sequencing (NGS) data analysis methods. The successful candidate should be able to quickly understand the state-of-art computational biology techniques, prototype them and perform benchmarking studies. The candidate must also be comfortable working with people from different disciplines and be able to present data analysis results in a clear and effective manner. The candidate is also expected to interact with customers as needed, write technical reports and publish new methods and/or data analysis findings in public forums.</p>

<p>Candidate Requirements: A PhD in computer science, computational biology, Bioinformatics, or a related field, along with sufficient programming skills for prototyping. Experience with next generation sequencing data analysis is required. Candidates with MS degree but with relevant work experience can also be considered. The successful candidate must be motivated and capable of working independently as well as in team environment.</p>

<p>Eligible and interested candidates can email your resumes to rohit at strandls dot com</p>

<p>About Strand Life Sciences: Strand was founded in 2000 by computer science and mathematics professors who recognized the need to automate and integrate life science data analysis through an algorithmic and computational approach. Strand’s solutions for life sciences research are robust and easy to use by the most novice user while powerful and configurable for the bioinformatician. Using its award-winning application development platform, AVADIS®, Strand builds innovative products that enable fast and cutting-edge analysis for basic and clinical research, drug discovery and development.</p>

<p>http://www.avadis-ngs.com/careers</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/8943/roth-lab</guid>
  <pubDate>Tue, 11 Mar 2014 17:43:45 -0500</pubDate>
  <link></link>
  <title><![CDATA[Roth Lab]]></title>
  <description><![CDATA[
<p>The Roth Lab seeks insight into biological systems through genome- and proteome-scale experimentation and analysis.</p>

<p>Current computational interests:</p>

<p>Systematic analysis of genetic epistasis to identify redundant or compensatory systems and to reveal order of action in genetic pathways.<br />Using knockout, knockdown, or overexpression, or other perturbation experiments in combinations of genes in S. cerevisiae, C. elegans or mouse.<br />Using genome-scale genotyping of natural polymorphisms in S. cerevisiae and human populations.<br />Alternative splicing and its relationship to protein interaction networks.<br />Integrating large-scale studies including phenotype, genetic epistasis, protein-protein and transcription-regulatory interactions and sequence patterns to quantitatively assign function to genes and guide experimentation.</p>

<p>More at http://llama.mshri.on.ca/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/9039/postdoc-position-in-computational-biology</guid>
  <pubDate>Fri, 14 Mar 2014 01:38:49 -0500</pubDate>
  <link></link>
  <title><![CDATA[Postdoc Position in Computational Biology]]></title>
  <description><![CDATA[
<p>The Computational Biology Group of Interdisciplinary Center for<br />Clinical Research (IZKF) Aachen, RWTH Aachen University Hospital,<br />Aachen, invites applicants for PhD candidate or postdoctoral position<br />in computational biology in one of the following topics:</p>

<p>1) Statistical machine learning methods for the analysis of medical<br />epigenomics data.</p>

<p>2) Sequence analysis algorithms for detection of RNA-DNA interactions.</p>

<p>Applicants should hold a M.Sc . or PhD in Computer Science or related<br />areas. Experience in the analysis of biological sequences, gene<br />expression and gene regulation is desirable. The candidate should have<br />solid programming skills (C, Python and/or R) and acquaintance with<br />Linux. Experience with high performance computing is a plus. The<br />working language of the group is English.</p>

<p>The position is based on the German TV-L 13 salary scale, including<br />all German social benefits (health insurance and pension scheme). The<br />expected starting date is September 2014. Interested candidates should<br />send a CV, statement of research interests and the names of three<br />references to jobs@costalab.org.</p>

<p>More at http://costalab.org/wp/phd-and-postdoc-position-in-computational-biology/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</guid>
	<pubDate>Wed, 05 Jun 2019 15:04:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</link>
	<title><![CDATA[Bioinformatics for Precision Oncology - Online Training Program, Summer 2019]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/05/OncologyBioinformatics.jpeg" width="600" height="337.5" alt="image" style="border: 0px;"></p><p>The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register:&nbsp;https://edu.t-bio.info/bioinformatics-training-precision-oncology/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/9207/biogeek-fun</guid>
	<pubDate>Sun, 16 Mar 2014 06:33:31 -0500</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/9207/biogeek-fun</link>
	<title><![CDATA[BioGeek Fun]]></title>
	<description><![CDATA[<p>1. A futuristic computational biology student was told to write "It is in my gene!!!" on the board 100 times as a punishment. here's his response -<br /><br />use warnings;<br />for ($count=1; $count &lt;=100; $count++) { print "It is in my gene!!!";}<br /><br />I guess, he is gonna to be a real biogeek. Nice try though. Smart kid.</p><p>&nbsp;</p><p>2. In some perl script I found this <br />&nbsp;. . . . . .<br />&nbsp;. . . . . .<br /># It works for me, only God understood how it is working<br />while (/(&lt;\/[^&gt;]+&gt;)|(&lt;[^&gt;]+&gt;)|(&lt;[^&gt;]+&gt;)$|([^&gt;&lt;]+)/go) {<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; $startGene=$1;<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; $beginChromosome=$2;<br />&nbsp;&nbsp; &nbsp;<br />. . . . . .<br />&nbsp;.. . . . . .<br />}</p><p>&nbsp;</p><p>3. One more interesting message in Perl found &hellip;. It will must tickle you bone :) <br />open(my $fh, "&lt;", "gene.txt")&nbsp;&nbsp; &nbsp;or kill " Me if you think this is a mistake :$!";<br /><br /></p><p>&nbsp;</p><p>4. From the Perl <br /><br />&nbsp; while () {&nbsp; # "The Mothership Connection is here!"<br />&nbsp;&nbsp; &nbsp;print &ldquo;$_\n&rdquo;; # Printing the offspring :)</p><p>&nbsp;</p><p>5. Perl message<br />if ($1) { print &ldquo;Just found a the error in chromosome !!!, yahoo&hellip;&rdquo;; else { &ldquo;That is not error, but mutation you moron!&rdquo;;</p><p>&nbsp;</p><p>6. One genome database curator walk in wine bar asked the bartender:<br />CREATE TABLE gene IF NOT EXISTS SexOnTheBeach;</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</guid>
	<pubDate>Thu, 24 Oct 2019 10:30:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</link>
	<title><![CDATA[IITM-Tokyo Tech Joint Symposium]]></title>
	<description><![CDATA[<p>The IITM-Tokyo Tech Joint Symposium is a biannual international symposium held in Indian Institute of Technology Madras (IITM), India in collaboration with Tokyo Institute of Technology (Tokyo-Tech), Japan. During the symposium, experts in various domains of Bioinformatics gather from India and Japan under one roof to discuss and present their works. This provides an unique opportunity to the researchers and students to learn the frontiers and interact with eminent scientists in Bioinformatics. The 5th IITM - Tokyo Tech Joint Symposium titled "Current trends in Bioinformatics: Big data analysis, machine learning and drug design", will be held on 6th - 7th March 2020 in IITM, Chennai, India.</p><p>The symposium will focus on topics in the below mentioned areas.</p><p>Topics: Algorithms for biomolecular sequences / structures Bioinformatics databases and tools Protein function Structure based drug design Machine learning Deep learning Large scale data analysis Big Data NGS Analysis Protein interactions/network Molecular modelling/docking/screening Biomolecular structure and function More</p><p>Info: https://web.iitm.ac.in/bioinfo2/symposium2020/home</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/9327/jarvis%E2%80%99-laboratory</guid>
  <pubDate>Tue, 18 Mar 2014 18:53:47 -0500</pubDate>
  <link></link>
  <title><![CDATA[Jarvis’ laboratory]]></title>
  <description><![CDATA[
<p>Dr. Jarvis’ laboratory studies the neurobiology of vocal communication. We want to know how the brain generates, perceives, and learns behavior. We use vocal communication as a model behavior. Emphasis is placed on the molecular pathways involved in the perception and production of learned vocalizations. We use an integrative approach that combines behavioral, anatomical, electrophysiological, and molecular biological techniques. The main animal model used is songbirds, one of the few vertebrate groups that evolved the ability to learn vocalizations. The overall goal of the research is to advance knowledge of the neural mechanisms for vocal learning and basic mechanisms of brain function.</p>

<p>Lab page: http://jarvislab.net/</p>
]]></description>
</item>

</channel>
</rss>