BOL: Related items

BRaVa Browser

Jitendra Narayan — Sun, 23 Aug 2026 10:32:19 -0500

BRaVa Browser is an interactive web tool for exploring rare genetic variant associations. It allows users to search and visualize rare variant association results across genes and traits, making it easier to investigate potential relationships between genetic variation and disease or other phenotypes.

More at https://nikbaya.github.io/brava_browser/#/

Address of the bookmark: https://nikbaya.github.io/brava_browser/#/

Krona

Jit — Wed, 22 Mar 2017 04:47:35 -0500

Krona allows hierarchical data to be explored with zooming, multi-layered pie charts. Krona charts can be created using an Excel template or KronaTools, which includes support for several bioinformatics tools and raw data formats. The interactive charts are self-contained and can be viewed with any modern web browser (see Browser support).

Address of the bookmark: https://github.com/marbl/Krona/wiki

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

VG: variation graph data structures, interchange formats, alignment, genotyping, and variant calling methods

Jit — Tue, 28 Jan 2020 03:53:24 -0600

Variation graphs provide a succinct encoding of the sequences of many genomes. A variation graph (in particular as implemented in vg) is composed of:

nodes, which are labeled by sequences and ids
edges, which connect two nodes via either of their respective ends
paths, describe genomes, sequence alignments, and annotations (such as gene models and transcripts) as walks through nodes connected by edges

Address of the bookmark: https://github.com/vgteam/vg

AlfaPang: alignment free algorithm for pangenome graph construction

BioStar — Thu, 28 Aug 2025 02:56:35 -0500

AlfaPang constructs variation graphs, leveraging its alignment-free and reference-free approach, based solely on intrinsic sequence properties. This design allows AlfaPang's runtime and memory usage to scale linearly with the size of input sequences, enabling it to handle significantly larger genome sets compared to other methods.

Address of the bookmark: https://github.com/AdamCicherski/AlfaPang

SALSA: A tool to scaffold long read assemblies with Hi-C

Jit — Fri, 15 Jun 2018 04:01:15 -0500

This code is used to scaffold your assemblies using Hi-C data. This version implements some improvements in the original SALSA algorithm. If you want to use the old version, it can be found in the old_salsa branch. To use the latest version, first run the following commands: cd SALSA make To run the code, you will need Python 2.7, BOOST libraries and Networkx(version lower than 1.2). If you consider using this tool, please cite our publication which describes the methods used for scaffolding. Ghurye, J., Pop, M., Koren, S., Bickhart, D., & Chin, C. S. (2017). Scaffolding of long read assemblies using long range contact information. BMC genomics, 18(1), 527. Link Ghurye, J., Rhie, A., Walenz, B.P., Schmitt, A., Selvaraj, S., Pop, M., Phillippy, A.M. and Koren, S., 2018. Integrating Hi-C links with assembly graphs for chromosome-scale assembly. bioRxiv, p.261149 Link For any queries, please either ask on github issue page or send an email to Jay Ghurye (jayg@cs.umd.edu).

Address of the bookmark: https://github.com/machinegun/SALSA

ONT assembly and Illumina polishing pipeline

Jit — Thu, 23 Nov 2017 10:13:42 -0600

This pipeline performs the following steps:

Assembly of nanopore reads using Canu.
Polish canu contigs using racon (optional).
Map a paired-end Illumina dataset onto the contigs obtained in the previous steps using BWA mem.
Perform correction of contigs using pilon and the Illumina dataset.

Address of the bookmark: https://github.com/nanoporetech/ont-assembly-polish

dnaPipeTE: de-novo assembly & annotation Pipeline for Transposable Elements

Rahul Nayak — Sat, 02 Dec 2017 18:25:44 -0600

dnaPipeTE (for de-novo assembly & annotation Pipeline for Transposable Elements), is a pipeline designed to find, annotate and quantify Transposable Elements in small samples of NGS datasets. It is very useful to quantify the proportion of TEs in newly sequenced genomes since it does not require genome assembly and works on small datasets (< 1X).

dnaPipeTE is developped by Clément Goubert, Laurent Modolo and the TREEP team of the LBBE: http://lbbe.univ-lyon1.fr/-Equipe-Elements-transposables-.html?lang=en
You can find the original publication in GBE here: https://academic.oup.com/gbe/article/7/4/1192/533768

output examples of quantification and TE landscape (relative age) produced by dnaPipeTE

Address of the bookmark: https://github.com/clemgoub/dnaPipeTE

Ra assembler - a de novo DNA assembler for third generation sequencing data

biogeek — Wed, 27 Dec 2017 20:36:54 -0600

Integration of the Ra assembler - a de novo DNA assembler for third generation sequencing data developed on Faculty of Electrical Engineering and Computing (FER), Ruder Boskovic Institute (RBI) and Genome Institute of Singapore (GIS).

Ra is in development since 2014 in the form of several separate components that used to be run individually.
This project aims to ease the usage of Ra by integrating it into a complete de novo assembly tool.

Unlike other state-of-the-art assemblers, Ra does not have an error correction step. Instead, it relies on detecting overlaps using a very sensitive and specific overlapper ("graphmap -w owler", https://github.com/isovic/graphmap) and constructing and reducing an overlap graph (Ra layout, https://github.com/mariokostelac/ra).

Address of the bookmark: https://github.com/mariokostelac/ra-integrate/

AlignGraph: algorithm for secondary de novo genome assembly guided by closely related references

Manisha Mishra — Tue, 17 Apr 2018 16:21:20 -0500

AlignGraph is a software that extends and joins contigs or scaffolds by reassembling them with help provided by a reference genome of a closely related organism.

Using AlignGraph

AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]

Address of the bookmark: https://github.com/baoe/AlignGraph