<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/42809?offset=460</link>
	<atom:link href="https://bioinformaticsonline.com/related/42809?offset=460" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8198/scientist-positions-at-rajiv-gandhi-centre-for-biotechnology</guid>
  <pubDate>Thu, 06 Feb 2014 23:18:49 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist Positions at Rajiv Gandhi Centre for Biotechnology]]></title>
  <description><![CDATA[
<p>Rajiv Gandhi Centre for Biotechnology</p>

<p>An Autonomous National Institute under Government of India,<br />Ministry of Science &amp; Technology<br />Department of Biotechnology</p>

<p>No: RGCB/ Advt./2014/1   <br />January 24, 2014</p>

<p>Scientist Positions</p>

<p>Group Leader in Computational Biology/Bioinformatics<br />A highly motivated and innovative individual who will pursue basic research, solve biological problems with emphasis on computational and quantitative experimental methods and build active bridges to translational research. The scientist will also provide computational biology support to analyze complex data sets generated by RGCB scientists and collaborators.</p>

<p>Location: Thiruvananthapuram (Trivandrum)</p>

<p>The above positions will be at the E-II, F or equivalent levels. For senior applicants with an outstanding track record, an option of a contract career path for research excellence at Scientist G or H equivalent level can also be discussed. All positions will initially be for 5 years. Essential and desired qualifications as well as other relevant details for all the above positions are posted on the RGCB website (http://www.rgcb.res.in). The last date for receiving applications is March 14, 2014.   </p>

<p>Sd/-<br />Director</p>

<p>Rajiv Gandhi Centre for Biotechnology<br />Thycaud, P.O., Poojappura,<br />Thiruvananthapuram, Kerala, India-695 014<br />Ph.: 91-471-2529400 (30 Lines), 2347975, 2348104, 2348753, 2345899<br />Fax: 91-471-2348096, 2346333</p>

<p>More at http://rgcb.res.in/jobs.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/8382/c-dac-launch-supercomputing-facility-param-bio-blaze</guid>
	<pubDate>Tue, 18 Feb 2014 11:55:14 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/8382/c-dac-launch-supercomputing-facility-param-bio-blaze</link>
	<title><![CDATA[C-DAC launch supercomputing facility "Param Bio Blaze" !!!]]></title>
	<description><![CDATA[<p>The bioinformatics centre at Centre for Development of Advanced Computing (C-DAC) completed 10 years, this month. Established in 2004, the centre has been widely used by numerous researchers across the globe and has an ultimate aim of making personalised drugs depending on the composition of a human body.<br /><br />When biological data is processed using computer science, statistics, mathematics and engineering, it constitutes bioinformatics. The technological advancements are bringing new dimensions to the understanding of molecular basis of living organisms. There is immense data generated due to computing, but storage and analysis of this data is becoming a challenge, therefore there is an urgent need of supercomputers.</p><p>The&nbsp;C-DAC will launch Param Bio Blaze, a supercomputing facility, to address the challenges in bioinformatics on Tuesday at a three-day symposium, titled: 'Accelerating biology: Computing life'. The supercomputing facility will be inaugurated on Tuesday by Ramakrishna Ramaswamy, vice-chancellor, Central University of Hyderabad at the Yashada. The new C-DAC's facility will have a capacity of 10 teraflop and will be able to analyse human cells and its functions.</p><p><img src="http://www.datacenterjournal.com/wp-content/uploads/2012/06/supercomputer.jpg" alt="image" width="1024" height="632" style="border: 0px; border: 0px;"></p><p><br />Param Bio Blaze will help have a larger storage space and better computing facility for the bioinformatics sector. The facility will help capture the movement of molecules and also interaction between two molecules and the effects.<br /><br />Applications of Param BioBlaze<br /><br />- Collaboration with National Centre for Cell Science for research on Malaria and understanding how the disease spreads<br /><br />- Collaborative work with Tata Memorial hospital on breast cancer and find out the difference between normal tissues and tissues from breast cancer patients<br /><br />- Designing anti-cancer molecules, a collaborative research with the University of Pune</p><p>Reference:</p><p>Times of India</p><p>Image:datacenterjournal.com</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/8330/atlas-of-ancient-inter-ethnic-group</guid>
	<pubDate>Fri, 14 Feb 2014 13:16:20 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/8330/atlas-of-ancient-inter-ethnic-group</link>
	<title><![CDATA[Atlas of ancient inter-ethnic group !!!]]></title>
	<description><![CDATA[<p>Now a dayz, almost 3% of the world's population lived outside their country of origin. These migration is increasingly being perceived as a force that can contribute to development, and an integral aspect of the global development process.&nbsp; While migrants make important contributions to the economic prosperity of their host countries, the flow of financial, technological, social and human capital back to their countries of origin also is having a significant impact on poverty reduction and economic development.</p><p>However, the ancient invasions and migrations to slavery and trade, history is embroidered with events that led to interactions between previously separate populations. Early humans migrated due to many factors such as changing climate and landscape and inadequate food supply. Historical migration of human populations begins with the movement of Homo erectus out of Africa across Eurasia about a million years ago. Homo sapiens appear to have occupied all of Africa about 150,000 years ago, moved out of Africa 70,000 years ago, and had spread across Australia, Asia and Europe by 40,000 years BC. Indo-Aryan migration from the Indus Valley to the plain of the River Ganges in Northern India is presumed to have taken place in the Middle to Late Bronze Age, contemporary to the Late Harappan phase in India (ca. 1700 to 1300 BC). From 180 BC, a series of invasions from Central Asia followed, including those led by the Indo-Greeks, Indo-Scythians, Indo-Parthians and Kushans in the northwestern Indian subcontinent.</p><p><img src="http://upload.wikimedia.org/wikipedia/commons/3/37/Map-of-human-migrations.jpg" alt="image" style="border: 0px; border: 0px;"></p><p>Using the recent advance technologies researchers have created a historical atlas of instances of such mixing. They use a sophisticated statistical method for making inferences about human history and&nbsp;infer populations interbredings ( happen over the past 4,000 years) with an ease.<br /><br />The study published the findings and presented with an interactive map. http://admixturemap.paintmychromosomes.com/</p><p>These sort of genomic study have some limilation. It is hard to precisely define sources of mixing when it occurred between genetically similar groups, and scenarios involving multiple waves of mixing over time or between multiple groups can be difficult to tease apart. But it is believed that larger sample sizes will improve resolution. These high resolution will provide a deeper understanding of human history.</p><p>Reference:</p><p>http://www.sciencemag.org/content/early/2014/01/28/science.1245938</p><p>http://www.ncbi.nlm.nih.gov/pubmed/21390129?dopt=Abstract&amp;holding=npg</p><p>http://www.csulb.edu/~kmacd/paper-ethnicity.html</p><p>Image: Wikipedia</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/9055/computational-biologist-scientist-strand-life-sciences</guid>
  <pubDate>Fri, 14 Mar 2014 11:36:56 -0500</pubDate>
  <link></link>
  <title><![CDATA[Computational Biologist Scientist @ Strand Life Sciences]]></title>
  <description><![CDATA[
<p>We are looking for a motivated application scientist to help evaluate, compare, and develop next generation sequencing (NGS) data analysis methods. The successful candidate should be able to quickly understand the state-of-art computational biology techniques, prototype them and perform benchmarking studies. The candidate must also be comfortable working with people from different disciplines and be able to present data analysis results in a clear and effective manner. The candidate is also expected to interact with customers as needed, write technical reports and publish new methods and/or data analysis findings in public forums.</p>

<p>Candidate Requirements: A PhD in computer science, computational biology, Bioinformatics, or a related field, along with sufficient programming skills for prototyping. Experience with next generation sequencing data analysis is required. Candidates with MS degree but with relevant work experience can also be considered. The successful candidate must be motivated and capable of working independently as well as in team environment.</p>

<p>Eligible and interested candidates can email your resumes to rohit at strandls dot com</p>

<p>About Strand Life Sciences: Strand was founded in 2000 by computer science and mathematics professors who recognized the need to automate and integrate life science data analysis through an algorithmic and computational approach. Strand’s solutions for life sciences research are robust and easy to use by the most novice user while powerful and configurable for the bioinformatician. Using its award-winning application development platform, AVADIS®, Strand builds innovative products that enable fast and cutting-edge analysis for basic and clinical research, drug discovery and development.</p>

<p>http://www.avadis-ngs.com/careers</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</guid>
	<pubDate>Wed, 05 Jun 2019 15:04:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</link>
	<title><![CDATA[Bioinformatics for Precision Oncology - Online Training Program, Summer 2019]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/05/OncologyBioinformatics.jpeg" width="600" height="337.5" alt="image" style="border: 0px;"></p><p>The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register:&nbsp;https://edu.t-bio.info/bioinformatics-training-precision-oncology/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/8943/roth-lab</guid>
  <pubDate>Tue, 11 Mar 2014 17:43:45 -0500</pubDate>
  <link></link>
  <title><![CDATA[Roth Lab]]></title>
  <description><![CDATA[
<p>The Roth Lab seeks insight into biological systems through genome- and proteome-scale experimentation and analysis.</p>

<p>Current computational interests:</p>

<p>Systematic analysis of genetic epistasis to identify redundant or compensatory systems and to reveal order of action in genetic pathways.<br />Using knockout, knockdown, or overexpression, or other perturbation experiments in combinations of genes in S. cerevisiae, C. elegans or mouse.<br />Using genome-scale genotyping of natural polymorphisms in S. cerevisiae and human populations.<br />Alternative splicing and its relationship to protein interaction networks.<br />Integrating large-scale studies including phenotype, genetic epistasis, protein-protein and transcription-regulatory interactions and sequence patterns to quantitatively assign function to genes and guide experimentation.</p>

<p>More at http://llama.mshri.on.ca/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</guid>
	<pubDate>Thu, 24 Oct 2019 10:30:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</link>
	<title><![CDATA[IITM-Tokyo Tech Joint Symposium]]></title>
	<description><![CDATA[<p>The IITM-Tokyo Tech Joint Symposium is a biannual international symposium held in Indian Institute of Technology Madras (IITM), India in collaboration with Tokyo Institute of Technology (Tokyo-Tech), Japan. During the symposium, experts in various domains of Bioinformatics gather from India and Japan under one roof to discuss and present their works. This provides an unique opportunity to the researchers and students to learn the frontiers and interact with eminent scientists in Bioinformatics. The 5th IITM - Tokyo Tech Joint Symposium titled "Current trends in Bioinformatics: Big data analysis, machine learning and drug design", will be held on 6th - 7th March 2020 in IITM, Chennai, India.</p><p>The symposium will focus on topics in the below mentioned areas.</p><p>Topics: Algorithms for biomolecular sequences / structures Bioinformatics databases and tools Protein function Structure based drug design Machine learning Deep learning Large scale data analysis Big Data NGS Analysis Protein interactions/network Molecular modelling/docking/screening Biomolecular structure and function More</p><p>Info: https://web.iitm.ac.in/bioinfo2/symposium2020/home</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>