<![CDATA[BOL: Related items]]> https://bioinformaticsonline.com/related/42810?offset=30 https://bioinformaticsonline.com/bookmarks/view/21703/coding-ground Tue, 17 Mar 2015 00:47:20 -0500 https://bioinformaticsonline.com/bookmarks/view/21703/coding-ground <![CDATA[Coding Ground]]> Online coding group for most of the programming languages.

Code in almost all popular languages using Coding Ground. Edit, compile, execute and share your projects, 100% cloud.

http://www.tutorialspoint.com/codingground.htm

Address of the bookmark: http://www.tutorialspoint.com/codingground.htm

]]> Jitendra Narayan https://bioinformaticsonline.com/file/view/22047/binc-sample-question-paper Thu, 16 Apr 2015 09:14:14 -0500 https://bioinformaticsonline.com/file/view/22047/binc-sample-question-paper <![CDATA[BINC Sample Question Paper !!!]]> BINC sample question paper round TWO.

]]> Jitendra Narayan https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics Sun, 24 May 2015 09:28:33 -0500 https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics <![CDATA[Perl One liner basics !!]]> Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

]]> Abhimanyu Singh https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl Tue, 09 Jun 2015 23:38:44 -0500 https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl <![CDATA[Frequent words problem solution by Perl]]>

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

]]> Jit https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl Wed, 10 Jun 2015 00:17:17 -0500 https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl <![CDATA[Clump Finding Problem Solved with Perl]]> The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

]]> Jit https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics Tue, 23 Jun 2015 10:39:06 -0500 https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics <![CDATA[At what age did you gain passion in Bioinformatics?]]> Most of the bioinformatician were biologist ( yeah ... not all ;), and at later stage they gain a passion in Bioinformatics and learn it. When did you get inclined towards computational analysis of biological data?

]]> Jit https://bioinformaticsonline.com/bookmarks/view/23892/bioinformatics-made-easy-search-bioinformatics-tools-and-run-genomic-analysis-in-the-cloud Thu, 20 Aug 2015 02:21:20 -0500 https://bioinformaticsonline.com/bookmarks/view/23892/bioinformatics-made-easy-search-bioinformatics-tools-and-run-genomic-analysis-in-the-cloud <![CDATA[Bioinformatics Made Easy Search: Bioinformatics tools and run genomic analysis in the cloud]]> InsideDNA makes hundreds of bioinformatics tools immediately available to run via an easy-to-use web interface and allows an accurate search across all functions, tools and pipelines.

With InsideDNA, you can upload and store your own genomic/genetic datasets in a limitless cloud space, and instantly analyze it with a powerful compute instance, without any tool installation or set up hassle.

More at https://insidedna.me/

Address of the bookmark: https://insidedna.me/

]]> Rahul Nayak https://bioinformaticsonline.com/opportunity/view/41905/research-associate-bioinformatics-in-iisc-recruitment-2020 Tue, 23 Jun 2020 21:53:34 -0500 <![CDATA[Research Associate Bioinformatics in IISc Recruitment 2020]]> Research Associate Bioinformatics in IISc Recruitment 2020

Essential Qualifications: Ph.D. (Bioinformatics/ Biophysics/ Biotechnology or any other stream of biological/ physical sciences) with a minimum of two publications in reputed peer reviewed journals in the area of structural bioinformatics or biophysics or biomolecular modeling/ simulation.

Job description: Development of bioinformatics tools and algorithms/software for structure based analysis of biomolecular systems. Programmatic access to major biomolecular databases using APIs Knowledge based prediction and analysis of biomolecular structure, function and interactions. Docking/simulations for inhibitor design.

Desirable Qualifications (Research Associate/s): i) Strong computer programming skills (in Python/PERL/PHP or C++ or object oriented database management systems like MySQL etc or scripting languages under LINUX/UNIX environment).

ii) Extensive experience in computational analysis of biomolecular structure/interactions and usage of advanced biomolecular simulation softwares. iii) Adequate knowledge of major databases, webservers and softwares in the area of biomolecular structure/function and drug design. iv) Familiarity with Parallel Programming environments and experience in usage of high-end HPC clusters.

The candidates must highlight their experience in above mentioned fields/topics in their CV. Initial appointment will be for a period of 1 year, subject to extension after review of performance.

Emoluments: As per DST, GOI norms and commensurate with experience.

More at https://www.iisc.ac.in/positions-open/

]]> https://bioinformaticsonline.com/pages/view/42813/bioinformatics-in-africa-part5-nigeria Sat, 06 Feb 2021 21:13:47 -0600 https://bioinformaticsonline.com/pages/view/42813/bioinformatics-in-africa-part5-nigeria <![CDATA[Bioinformatics in Africa: Part5 - Nigeria]]> Covenant University (CU)­Ota:
Covenant University (with her enriching and growing state­of­the­art laboratories in the area of  science and technology, arts, business and social sciences) is presently the Best University in  Nigeria (Private University category), based on the recent over­all rating just concluded by the  Nigeria   University   Commission   (NUC).   Recently,   Covenant   University   has   initiated   the  establishment of a Centre for Applied Biotech, Bio­Informatics and Microbiology (CBBM) to be  situated at the University. The institute has been designed to be a Public­Private Partnership for a productive synergy b/w Academia, Industry and Government. The whole concept is still evolving  and more details will be release soon. As regards CBBM, a dedicated computing lab is in plan, but even our computing capacity is  presently enormous. In the department of Computer and Information Sciences, we have more than  250 Pentium 4 PCs set aside for teaching and research purposes. Furthermore, we have several  moderate speed PCs at the Postgraduate research lab and our engineering departments and units.  Our wet lab facilities is presently minimal (basic for teaching), the Centre requirement as it touches  the wet­laboratories is also set to upgrade this to basic tools expected at an international centre of learning.

University of Ibadan (UIB)­Ibadan:
There has been significant increase in the number of bioinformatics activities in Nigeria (and West Africa) since 2003 when the program was initiated by the West African Biotechnology Workshops Series (WABWS, http://www.wabw.org) at the University of Ibadan, Nigeria (in collaboration with  the South African National Bioinformatics Institute (SANBI, http:/www.sanbi.ac.za). Workshops  that were open to scientists from all African countries have seen a very high number of applications  from scientists based in West Africa. The encouraging desire to acquire cutting­edge skills to  computational process data and extract useful knowledge from genome projects led to the interest of  the West African Biotechnology Workshops (WABW) to develop an agenda to address the  bioinformatics skills gap among scientists in West Africa. An increased commitment from agencies  like NEPAD would be required in the provision of infrastructure to establish and sustain regional  and national networks.

University of Ilorin (UIL)­Ilorin:
The University of Ilorin was established in 1976 by the Federal Government of Nigeria.  Bioinformatics activities started at the University in February 2003 with the establishment of the  West African Bioinformatics Research Initiative (WABRI). However, progress has been rather slow  due to inadequate funding. We are mainly engaged in Bioinformatics training at the introductory  level and proteomics studies on various species of malaria parasites. Recently, we became interested  in comparative genome analysis of various species of  Plasmodium  and the comparison of  chloroquine sensitive and chloroquine resistant strains of Plasmodium falciparum. Other activities  and areas of interest can be seen on our website, http://www.wabri.org, although not all our  proposed interests have been fully implemented due to our level of funding.

Training:
The University of Ilorin has introduced M.Sc. and Ph.D. programmes in Computer Science (with  options in Bioinformatics). The programme is based in the Department of Computer Science and  emphasis is on the development of algorithms to solve problems in bioinformatics. The Covenant University offers M.Sc. and Ph.D in Computer Science with option in Bioinformatics  (Computational Biology). Furthermore, through affiliated departments, the CBBM is been design to award Diploma and Degree certificates in Biotechnology.

Web sites and links: http://www.covenantuniversity.com http://www.run.edu.ng http://www.uniben.edu http://www.wabri.org http://www.wabw.org http://www.unilorin.edu.ng http://www.wabri.org http://www.asopah.org

]]> BioStar https://bioinformaticsonline.com/pages/view/35805/python-learning-resources-for-bioinformatics-and-computational-biologist Fri, 02 Mar 2018 06:54:15 -0600 https://bioinformaticsonline.com/pages/view/35805/python-learning-resources-for-bioinformatics-and-computational-biologist <![CDATA[Python learning resources for bioinformatics and computational biologist !]]> Python is a general-purpose language, which means it can be used to build just about anything, which will be made easy with the right tools/libraries.

Professionally, Python is great for backend web development, data analysis, artificial intelligence, and scientific computing. Many developers have also used Python to build productivity tools, games, and desktop apps, so there are plenty of resources to help you learn how to do those as well.

For pros and cons visit http://www.bestprogramminglanguagefor.me/why-learn-python and http://bioinformaticsonline.com/discussion/view/459/python-vs-perl

More resources at https://github.com/CodementorIO/Python-Learning-Resources

Following are the list of useful python programming resources:

]]> Jit