Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

In fact, there are huge demands for expert biological data analyst. It’s a fairly new  (not exactly) hot area, these bioinformatician are invaluable because they know and understand the significance of biological data for your research and how you can use it for better understanding of biological problems.

The bioinformatics can discover biological patterns and stories in genomic and proteomics data. They can develop the pipeline needed to properly collect, store and analyse it.

Once your research group is ready to make a larger investment and hire a bioinformatician to gain a competitive edge, there are several key traits to seek out in potential candidates. The best bioinformatician are:

1. Highly Skilled - programming skills, experience with the biological software and tools.

The biological data won’t illuminate much if the scientist analysing it doesn’t possess practical programming skills, experience with the biological software and tools and a thorough understanding of basic biological stuff. A solid background in mathematics and statistics is also an indispensable trait.

2. Insight - Real vision, robust understanding and deep insight.

In order to hire the best bioinformatics and computational biologist scientist for your needs, it is always recommended and mostly practiced by the recruiters, to ask each contender to write and develop a sample script/presentation based on a specific set of data you provide. Then, explore the approaches used to deal with data provided and pick up those candidates who convey real vision, robust understanding and deep insight.

3. Energetic – Curiosity to explore

Mostly natural curiosity and enthusiasm for solving big biological problems coupled with an ability to transform data into a scientific stories may place one candidate above the rest. In addition to achieve that, the bioinformatician should be agile enough to quickly modify their methods to suit changes within a particular research.

4. Researcher – Publications

Look for someone who has a keen sense and understanding of concern biological problems. You can judge it by looking at previously published papers and data. It is always recommended to have a look at GitHub and other repository for codes written by her/him.

5. Impressive communicator - Insight that can’t be expressed is worthless.

Good bioinformatics scientists are able to uncover biological patterns and are willing to explain those patterns in clear and helpful ways through thoughtful and open communication. In other words, they should must have good scientific writing skills. A computational biologis/bioinformatician  should know how to present the data and tell a scientific story through numbers/images.

Annotation

https://bigd.big.ac.cn/ncov/variation/annotation

Genome wharehouse 

https://bigd.big.ac.cn/gwh/browse/index

Released Genome

https://bigd.big.ac.cn/ncov/release_genome

Download data 

ftp://download.big.ac.cn/Genome/Viruses/Coronaviridae/

Raw data

https://bigd.big.ac.cn/gsa/browse/run/?tag=Coronaviridae

Address of the bookmark: https://bigd.big.ac.cn/ncov/about

Find the detail paper at http://bib.oxfordjournals.org/content/early/2013/06/25/bib.bbt043.full

Address of the bookmark: http://bib.oxfordjournals.org/content/early/2013/06/25/bib.bbt043.full

Reference@http://www.datasciencecentral.com/profiles/blogs/one-page-r-a-survival-guide-to-data-science-with-r

• Templates for the Data Scientist
  1. A Template for Preparing Data: *OnePageR - *R
  2. A Template for Building Models: *OnePageR - *R
• Getting Started as a Data Scientist
  1. Getting Started with R and Rattle: *Lecture - *Laboratory
  2. Introducing and Interacting with R: *Lecture - *Laboratory
  3. BasicR - OnePage(R) - Writing R scripts
• Dealing With Data
  1. Read Data into R: *OnePageR - *R
  2. Explore and Summarise Data: *OnePageR - *R
  3. Transform Data: *OnePageR - *R
  4. Dealing with Dates and Time: (PDF, R) Dates and Time
  5. Visualising Data with GGPlot2: *OnePageR - *R
  6. Visualising Data with Maps *OnePageR - *R
  7. Spatial (R) Spatial Analysis
  8. Handling Big Data *OnePageR - *R
• Descriptive Analytics
  1. Cluster Analysis: *Lecture - *OnePageR - *R
  2. Association Analysis: *Lecture
• Predictive Analytics
  1. Decision Trees: *Lecture - *OnePageR - *R - *Rattle
  2. Ensembles of Decision Trees: *Lecture - *OnePageR - *R
  3. SVM (R)
  4. KernLab (R)
  5. NeuralNetworks (R)
  6. NNet (R)
• Model Delivery
  1. Evaluating Models: *OnePageR - *R
  2. Evaluation (R)
  3. Scoring (R)
  4. PMML (R) Exporting Models for Deployment
• Advanced Topics
  1. Text Mining: *OnePageR - *R
• Advanced R Topics
  1. Plots (PDF, R) Miscellaneous Plots
  2. Functions (PDF, R) Writing Functions in R
  3. Parallel (PDF, R) Parallel Execution
  4. Packaging (R) Pulling it Together into a Package
  5. Doing R with Style: *OnePageR - *R
  6. Literate Data Mining with KnitR: *Lecture - *OnePageR - *

DBT Invites online applications from the bioinformatics students and requisitions from biotech/bioinformatics companies.

Biotech Industry :

Biotech/Bioinformatics companies interested to provide hands on industrial training to the students of Bioinformatics under BIITP may apply online. The companies would have no obligation towards any payments to trainees. The companies would be paid bench fee to cover expenses towards training. Trainees would be provided to companies subject to availability.

Attn: Bioinformatics Students

Bioinformatics students interested in training in biotech / bioinformatics companies may apply online. Stipend of Rs. 10,000/- per month will be paid to candidates placed for training. The candidates will be selected for training through an interview.

Eligiblity :

a) B.E /B.Tech./M.Sc./M.Tech./Advanced Post Graduate Diploma in Bioinformatics from an Indian recognized university with minimum 55% marks or equivalent grade at highest degree/diploma completed in the year 2015 or 2016 are only eligible to apply.

b) The Advanced Post Graduate diploma should be of at least one year duration after graduation.

c)  Students whose result of last semester/final year is not declared can also apply mentioning their marks upto the semester/year upto which result declared. The final result with original mark sheet(s) of all the semesters/years will have to be produced at the time of interview.

Application Procedure :

The online application form is available below :

Application Form For Students (New User)

Requisition form for companies (New User)

Already registered User Click Here

The following documents are to be sent to Mr. Manoj Gupta, Manager, Biotech Consortium India Limited, 5th floor, Anuvrat Bhawan, 210, Deen Dayal UpadhyayaMarg, New Delhi-110002.

More at http://www.bcil.nic.in/biitp2016-17/index.asp

Read more: https://edu.t-bio.info/amity-university-summer-bioinformatics-program-registrations-are-open/