<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/42813?offset=80</link>
	<atom:link href="https://bioinformaticsonline.com/related/42813?offset=80" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/43272/bioinformatics-head-bioinformatics-manager-iii-cancer-genomics-research-laboratory-at-frederick-national-laboratory</guid>
  <pubDate>Wed, 18 Aug 2021 00:19:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics Head (Bioinformatics Manager III), Cancer Genomics Research Laboratory at  Frederick National Laboratory]]></title>
  <description><![CDATA[
<p>Frederick National Laboratory seeking an enthusiastic, creative, and seasoned bioinformatics professional to join our leadership team and direct the exceptional Bioinformatics Group at the Cancer Genomics Research Laboratory (CGR).  CGR has a diverse team of bioinformatics and computational scientists that support all areas of bioinformatics and data analysis (infrastructure, data QC, pipeline development and maintenance, data curation and sharing, methodology development, statistical analyses, machine learning approaches, and scientific interpretation).</p>

<p>More at https://leidosbiomed.csod.com/ats/careersite/jobdetails.aspx?site=4&amp;c=leidosbiomed&amp;id=2040</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44204/bioinformatics-training-collections</guid>
	<pubDate>Sun, 05 Mar 2023 23:01:26 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44204/bioinformatics-training-collections</link>
	<title><![CDATA[Bioinformatics Training Collections !]]></title>
	<description><![CDATA[<p>Useful list of bioinformatics training collections @&nbsp;https://github.com/sib-swiss/training-collection</p><p>Address of the bookmark: <a href="https://github.com/sib-swiss/training-collection" rel="nofollow">https://github.com/sib-swiss/training-collection</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</guid>
	<pubDate>Fri, 27 Aug 2021 01:31:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</link>
	<title><![CDATA[biostarhandbook]]></title>
	<description><![CDATA[<p>Nice book collection for bioinformatician ... highly recommended.</p><p>Address of the bookmark: <a href="https://www.biostarhandbook.com/" rel="nofollow">https://www.biostarhandbook.com/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/10415/bioinformatician-stuck-in-wet-lab</guid>
	<pubDate>Tue, 06 May 2014 12:46:56 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/10415/bioinformatician-stuck-in-wet-lab</link>
	<title><![CDATA[Bioinformatician stuck in wet-lab]]></title>
	<description><![CDATA[<p>This guide is aimed at pet bioinformaticians, and is meant to guide them towards better career development.</p>
<p><strong>1. Make friends with local bioinformatics groups</strong><br> <strong>2. Talk to your computing group</strong><br> <strong>3. Obtain clear expectations</strong><br> <strong>4. Rewrite your job description</strong><br> <strong>5. Papers</strong><br> <strong>6. Attend bioinformatics meetings</strong><br> <strong>7. Try first, ask later</strong></p><p>Address of the bookmark: <a href="http://biomickwatson.wordpress.com/2013/04/23/a-guide-for-the-lonely-bioinformatician/" rel="nofollow">http://biomickwatson.wordpress.com/2013/04/23/a-guide-for-the-lonely-bioinformatician/</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/43329/postdoc-position-at-kiel-university-germany</guid>
  <pubDate>Sat, 28 Aug 2021 01:16:55 -0500</pubDate>
  <link></link>
  <title><![CDATA[Postdoc position at Kiel University, Germany]]></title>
  <description><![CDATA[
<p>In the Genomic Microbiology Group of Prof. Tal Dagan at the Institute<br />of Microbiology at Kiel University, Germany, a</p>

<p>Postdoc position (m/w/d)</p>

<p>in the field of computational evolutionary microbiology is available<br />for an initially limited period of 36 months at the earliest possible<br />date. The weekly working time corresponds to 100% of full employment<br />(If the legal requirements under collective bargaining law are met, the<br />tariff grouping is carried out up to pay scale 13 TV-L. The obligation<br />to teach amounts to 4 hours.</p>

<p>The Genomic Microbiology Group research interests are focused on<br />microbial genome evolution with an emphasis on the study of lateral gene<br />transfer. In our research we use both computational and experimental<br />approaches (see www.uni-kiel.de/genomik). The position offers the<br />opportunity to develop an independent research profile within the group<br />research focus. The successful applicant is expected to be involved<br />in teaching of bioinformatics and molecular evolution, including the<br />development of teaching materials (lectures/exercises/short videos).</p>

<p>Your profile:<br />· Doctoral or PhD degree in Molecular Evolution, Bioinformatics or<br />related fields.<br />· Knowledge and experience in programming (e.g., Python) and<br />biostatistical analysis (e.g., with R or MatLab).<br />· Any of the following expertise is an advantage: the analysis of<br />genomic or transcriptomic data, phylogenetic reconstruction,<br />comparative genomics.<br />· Good oral and written communication skills in English.<br />· Ability to teach in German is an advantage (alternatively, an<br />indication to do so from the 2nd year on).<br />· Skills and motivation to communicate and interact with other<br />scientists.<br /> <br />The Christian-Albrechts-University sees itself as a modern and<br />cosmopolitan employer. We welcome your application regardless of your age,<br />gender, cultural and social background, religion, ideology, disability<br />or sexual identity. We promote equality of the sexes.</p>

<p>The Christian-Albrechts-University is committed to the employment of<br />people with disabilities. Preference will be given to applications from<br />severely handicapped persons and persons of equal standing, provided<br />they are suitable.</p>

<p>We expressly welcome applications from people with a migration background.</p>

<p>For enquiries regarding the position, teaching obligations and research<br />topic please contact Prof. Tal Dagan: tdagan@ifam.uni-kiel.de.</p>

<p>Applications should be submitted by email to Mrs. Haacks<br />(dhaacks@ifam.uni-kiel.de) as a single PDF and include: (1) a letter of<br />motivation (max 1 page, Arial 11, line spacing 1.15), (2) CV, (3) PhD<br />certificate. Please use 'GMG postdoc application - [your name]'<br />as a subject.</p>

<p>Please, refrain from sending us application photos.</p>

<p>Application deadline:  August 31 2021 or until the position is<br />filled. Interviews will take place during September/October 2021. The<br />planned starting date for the position is flexible (but in 2021).</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/10881/special-project-scientist-%E2%80%93-sorghum-genomics</guid>
  <pubDate>Tue, 20 May 2014 00:34:39 -0500</pubDate>
  <link></link>
  <title><![CDATA[Special Project Scientist – Sorghum Genomics]]></title>
  <description><![CDATA[
<p>ICRISAT is seeking applications from Indian Nationals for a Special Project Scientist to work on a sorghum genomics activities related to sequencing/re-sequencing projects utilizing New Generation Sequencing platforms.</p>

<p>The Job detail</p>

<p>    Advancing the SNP-discovery and polymorphism assessment work across several germplasm panels representing global genetic diversity<br />    Population genetic and genomic analyses, testing the hypothesis related to adaptation in multiple geographic regions<br />    Develop SNP assays from large scale GBS and other re-sequencing data for several target traits utilizing available phenotyping data<br />    Combined analyses of genotypic and phenotypic data for discovery of marker-trait associations, and conducting GWAS<br />    Processing, analyzing, and archiving large-scale genomic data sets, assessing data quality, conducting analyses, interpreting findings, and communicating findings to others including preparation of reports, presentations, posters and journal articles<br />    Providing support to MSc and PhD students on topic related to its major core of research<br />    Any other work assigned by the supervisor</p>

<p>The Person:</p>

<p>    PhD in bioinformatics, genetics, computational biology preferably with 1 to 2 years of experience;<br />    familiar with standard bioinformatics tools and scripting languages and emerging and evolving software platforms relevant to bioinformatics and computational biology;<br />    ability to create new analytical pipelines; experience with handling large data sets;<br />    ability to program in at least two of the following: C++, PERL, Python, R, Java.<br />    will use next-generation sequencing technologies to generate marker data for genetic mapping and transcriptome data for expression QTL mapping, and will be responsible for data generation as well as data analysis.</p>

<p>Period and Remuneration: The assignment is for a period of two years, and can be extended for another year depending on performance. ICRISAT pays a very attractive all inclusive lump sum assignment fee payable in Indian Rupees.</p>

<p>How to Apply: Please send your application by email to icrisatjobs@cgiar.org, stating the job title (Special project Scientist-Sorghum Genomics) clearly in the subject column, addressed to the Director, Human Resources and Operations, ICRISAT, Patancheru, Andhra Pradesh 502 324, India, latest by 10 June 2014. The application should include an up-to-date Curriculum Vitae, a short statement of competencies and experience for the position, and the names and addresses (including phone/e-mail) of three referees. Only short-listed candidates will be contacted.</p>

<p>More at: http://www.icrisat.org/careers/Special-Project-Scientist-Sorghum-Genomics.htm</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44472/pipesnake-bioinformatics-best-practice-analysis-pipeline-for-phylogenomic-reconstruction</guid>
	<pubDate>Wed, 21 Feb 2024 06:19:41 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44472/pipesnake-bioinformatics-best-practice-analysis-pipeline-for-phylogenomic-reconstruction</link>
	<title><![CDATA[pipesnake: bioinformatics best-practice analysis pipeline for phylogenomic reconstruction]]></title>
	<description><![CDATA[<p dir="auto"><span>ausarg/pipesnake</span>&nbsp;is a bioinformatics best-practice analysis pipeline for phylogenomic reconstruction starting from short-read 'second-generation' sequencing data.</p>
<p dir="auto">The pipeline is built using&nbsp;<a href="https://www.nextflow.io/">Nextflow</a>, a workflow tool to run tasks across multiple compute infrastructures in a very portable manner. It uses Docker/Singularity containers making installation trivial and results highly reproducible. The&nbsp;<a href="https://www.nextflow.io/docs/latest/dsl2.html">Nextflow DSL2</a>&nbsp;implementation of this pipeline uses one container per process which makes it much easier to maintain and update software dependencies.</p><p>Address of the bookmark: <a href="https://github.com/AusARG/pipesnake" rel="nofollow">https://github.com/AusARG/pipesnake</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/10739/science-for-life-laboratory-scilifelab-sweden</guid>
  <pubDate>Sat, 10 May 2014 06:22:30 -0500</pubDate>
  <link></link>
  <title><![CDATA[Science for Life Laboratory (SciLifeLab)-Sweden]]></title>
  <description><![CDATA[
<p>Science for Life Laboratory (SciLifeLab) is a national center for molecular biosciences with focus on health and environmental research. The center combines frontline technical expertise with advanced knowledge of translational medicine and molecular bioscience. SciLifeLab is a national resource and a collaboration between four universities: Karolinska Institutet, KTH Royal Institute of Technology, Stockholm University and Uppsala University.</p>

<p>Webpage : https://www.scilifelab.se/about-us/<br />Opportunity: https://www.scilifelab.se/about-us/career/</p>
]]></description>
</item>

</channel>
</rss>