<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/42815?offset=80</link>
	<atom:link href="https://bioinformaticsonline.com/related/42815?offset=80" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44204/bioinformatics-training-collections</guid>
	<pubDate>Sun, 05 Mar 2023 23:01:26 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44204/bioinformatics-training-collections</link>
	<title><![CDATA[Bioinformatics Training Collections !]]></title>
	<description><![CDATA[<p>Useful list of bioinformatics training collections @&nbsp;https://github.com/sib-swiss/training-collection</p><p>Address of the bookmark: <a href="https://github.com/sib-swiss/training-collection" rel="nofollow">https://github.com/sib-swiss/training-collection</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</guid>
	<pubDate>Fri, 27 Aug 2021 01:31:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</link>
	<title><![CDATA[biostarhandbook]]></title>
	<description><![CDATA[<p>Nice book collection for bioinformatician ... highly recommended.</p><p>Address of the bookmark: <a href="https://www.biostarhandbook.com/" rel="nofollow">https://www.biostarhandbook.com/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/10415/bioinformatician-stuck-in-wet-lab</guid>
	<pubDate>Tue, 06 May 2014 12:46:56 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/10415/bioinformatician-stuck-in-wet-lab</link>
	<title><![CDATA[Bioinformatician stuck in wet-lab]]></title>
	<description><![CDATA[<p>This guide is aimed at pet bioinformaticians, and is meant to guide them towards better career development.</p>
<p><strong>1. Make friends with local bioinformatics groups</strong><br> <strong>2. Talk to your computing group</strong><br> <strong>3. Obtain clear expectations</strong><br> <strong>4. Rewrite your job description</strong><br> <strong>5. Papers</strong><br> <strong>6. Attend bioinformatics meetings</strong><br> <strong>7. Try first, ask later</strong></p><p>Address of the bookmark: <a href="http://biomickwatson.wordpress.com/2013/04/23/a-guide-for-the-lonely-bioinformatician/" rel="nofollow">http://biomickwatson.wordpress.com/2013/04/23/a-guide-for-the-lonely-bioinformatician/</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44930/bioinformatics-the-bridge-between-curiosity-and-discovery</guid>
	<pubDate>Mon, 24 Nov 2025 05:16:49 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44930/bioinformatics-the-bridge-between-curiosity-and-discovery</link>
	<title><![CDATA[Bioinformatics: The Bridge Between Curiosity and Discovery]]></title>
	<description><![CDATA[<p>In the sprawling universe of modern science, bioinformatics stands as one of the most transformative and empowering fields of our time. It is where biology meets computation, where data becomes meaning, and where curiosity becomes discovery. If you&rsquo;ve stepped into this world&mdash;or are considering it&mdash;here&rsquo;s your reminder: you&rsquo;re part of a revolution.</p><p><strong>Why Bioinformatics Matters More Than Ever</strong></p><p>Every day, our world generates massive amounts of biological data&mdash;from genome sequences to microbiome profiles to real-time pathogen surveillance. Hidden within these datasets are the answers to some of the greatest challenges humanity faces: emerging diseases, antimicrobial resistance, environmental stress, genetic disorders, sustainable agriculture, and more.</p><p>Bioinformatics isn&rsquo;t just a skill.<br />It&rsquo;s the language of the future of biology.</p><p>By mastering it, you give yourself the power to:</p><p>Decode genomes and understand life at its most fundamental level</p><p>Identify patterns no microscope could ever reveal</p><p>Predict disease outbreaks before they occur</p><p>Accelerate drug discovery with computational precision</p><p>Contribute to open-source tools that empower scientists worldwide</p><p>You don&rsquo;t just follow science&mdash;you drive it.</p><p><strong>Every Expert Was Once a Beginner</strong></p><p>Many newcomers feel intimidated. Command-line interfaces. R scripts. Python packages. Next-generation sequencing data. Complex machine learning models.</p><p>But here&rsquo;s the truth: every bioinformatician started exactly where you are now&mdash;curious, unsure, but excited.</p><p>No one writes perfect code on day one.</p><p>No one understands genomics pipelines immediately.</p><p>What makes you a bioinformatician is not perfection, but perseverance.</p><p>When your script throws a cryptic error&hellip;<br />When your data refuses to format&hellip;<br />When your pipeline runs for 6 hours only to crash&hellip;</p><p>Remember: this is part of the journey.<br />Every error teaches you. Every retry strengthens you. Every breakthrough energizes you.</p><p>Bioinformatics Is Not Just a Career&mdash;It&rsquo;s a Mindset</p><p>It&rsquo;s the mindset of:</p><p>Problem-solving.</p><p>Continuous learning.</p><p>Turning chaos into clarity.</p><p>Seeing what others can&rsquo;t.</p><p>Bioinformaticians are detectives of biological complexity. You sit at the intersection of innovation, using tools that can shape public health, medicine, agriculture, and ecology. Few fields give you such direct impact on the world.</p><p><strong>Your Contribution Matters</strong></p><p>As you work on your script, pipeline, genome, or model, remember:</p><p>Somewhere, your analysis might contribute to:</p><p>A new therapy</p><p>A faster diagnostic test</p><p>A better understanding of a pathogen</p><p>A more resilient crop</p><p>An open-source dataset that helps thousands</p><p>A discovery that rewrites textbooks</p><p>Your code may be small, but its ripple effect is powerful.</p><p>The Future Is Bioinformatics&mdash;And You Are Part of It</p><p>The world is shifting. Wet labs are integrating AI. Hospitals rely on genomic insights. Farmers use gene-level predictions. Governments monitor disease in real time. Students launch pipelines that become global tools.</p><p>This is a golden era&mdash;and you are not late.<br />You are exactly where you need to be.</p><p>Keep Pushing. Keep Learning. Keep Discovering.</p><p>Bioinformatics is a journey filled with challenges, but also with unmatched rewards.</p><p>So the next time you feel stuck, frustrated, or overwhelmed, remember:<br />You&rsquo;re building the science of tomorrow.</p><p>Be proud. Stay curious. Keep going.<br />Your work matters more than you think.</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/10881/special-project-scientist-%E2%80%93-sorghum-genomics</guid>
  <pubDate>Tue, 20 May 2014 00:34:39 -0500</pubDate>
  <link></link>
  <title><![CDATA[Special Project Scientist – Sorghum Genomics]]></title>
  <description><![CDATA[
<p>ICRISAT is seeking applications from Indian Nationals for a Special Project Scientist to work on a sorghum genomics activities related to sequencing/re-sequencing projects utilizing New Generation Sequencing platforms.</p>

<p>The Job detail</p>

<p>    Advancing the SNP-discovery and polymorphism assessment work across several germplasm panels representing global genetic diversity<br />    Population genetic and genomic analyses, testing the hypothesis related to adaptation in multiple geographic regions<br />    Develop SNP assays from large scale GBS and other re-sequencing data for several target traits utilizing available phenotyping data<br />    Combined analyses of genotypic and phenotypic data for discovery of marker-trait associations, and conducting GWAS<br />    Processing, analyzing, and archiving large-scale genomic data sets, assessing data quality, conducting analyses, interpreting findings, and communicating findings to others including preparation of reports, presentations, posters and journal articles<br />    Providing support to MSc and PhD students on topic related to its major core of research<br />    Any other work assigned by the supervisor</p>

<p>The Person:</p>

<p>    PhD in bioinformatics, genetics, computational biology preferably with 1 to 2 years of experience;<br />    familiar with standard bioinformatics tools and scripting languages and emerging and evolving software platforms relevant to bioinformatics and computational biology;<br />    ability to create new analytical pipelines; experience with handling large data sets;<br />    ability to program in at least two of the following: C++, PERL, Python, R, Java.<br />    will use next-generation sequencing technologies to generate marker data for genetic mapping and transcriptome data for expression QTL mapping, and will be responsible for data generation as well as data analysis.</p>

<p>Period and Remuneration: The assignment is for a period of two years, and can be extended for another year depending on performance. ICRISAT pays a very attractive all inclusive lump sum assignment fee payable in Indian Rupees.</p>

<p>How to Apply: Please send your application by email to icrisatjobs@cgiar.org, stating the job title (Special project Scientist-Sorghum Genomics) clearly in the subject column, addressed to the Director, Human Resources and Operations, ICRISAT, Patancheru, Andhra Pradesh 502 324, India, latest by 10 June 2014. The application should include an up-to-date Curriculum Vitae, a short statement of competencies and experience for the position, and the names and addresses (including phone/e-mail) of three referees. Only short-listed candidates will be contacted.</p>

<p>More at: http://www.icrisat.org/careers/Special-Project-Scientist-Sorghum-Genomics.htm</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34041/r-tuorial</guid>
	<pubDate>Mon, 31 Jul 2017 08:41:40 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34041/r-tuorial</link>
	<title><![CDATA[R tuorial]]></title>
	<description><![CDATA[<p>R learning resources</p>
<p>https://flowingdata.com/</p><p>Address of the bookmark: <a href="https://flowingdata.com/" rel="nofollow">https://flowingdata.com/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/10739/science-for-life-laboratory-scilifelab-sweden</guid>
  <pubDate>Sat, 10 May 2014 06:22:30 -0500</pubDate>
  <link></link>
  <title><![CDATA[Science for Life Laboratory (SciLifeLab)-Sweden]]></title>
  <description><![CDATA[
<p>Science for Life Laboratory (SciLifeLab) is a national center for molecular biosciences with focus on health and environmental research. The center combines frontline technical expertise with advanced knowledge of translational medicine and molecular bioscience. SciLifeLab is a national resource and a collaboration between four universities: Karolinska Institutet, KTH Royal Institute of Technology, Stockholm University and Uppsala University.</p>

<p>Webpage : https://www.scilifelab.se/about-us/<br />Opportunity: https://www.scilifelab.se/about-us/career/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/43008/list-of-useful-machine-ai-learning-resources</guid>
	<pubDate>Tue, 30 Mar 2021 08:56:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/43008/list-of-useful-machine-ai-learning-resources</link>
	<title><![CDATA[List of useful machine / ai learning resources !]]></title>
	<description><![CDATA[<p>ML&nbsp;cheatsheet !</p><p>https://github.com/remicnrd/ml_cheatsheet</p><p>Visual AI / ML</p><p>https://setosa.io/ev/</p><p>Simple and efficient tools for predictive data analysis</p><p><span>https://scikit-learn.org/stable/</span></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

</channel>
</rss>