<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/42877?offset=0</link>
	<atom:link href="https://bioinformaticsonline.com/related/42877?offset=0" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/24042/research-associate-bioinformatician-university-of-bristol</guid>
  <pubDate>Wed, 26 Aug 2015 05:46:29 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Associate Bioinformatician @ University of Bristol]]></title>
  <description><![CDATA[
<p>This 0.5 fte role will have specific responsibility for the bioinformatic side of a Health Innovation Challenged Fund (HICF) research project investigating the application of Next Generation Sequencing (NGS) technologies to the analysis of Minimal Residual Disease (MRD) in childhood Acute Lymphoblastic Leukaemia (ALL). The successful candidate will be responsible for designing and implementing an analysis pipeline primarily to fit with the clinical need, but with the capacity to answer innovative research questions.</p>

<p>For informal enquiries please contact Anne Walsh via email: anne.walsh@bristol.ac.uk.</p>

<p>Apply at http://www.bris.ac.uk/jobs/find/details.html?nPostingID=3639&amp;nPostingTargetID=13346&amp;option=28&amp;sort=DESC&amp;respnr=1&amp;ID=Q50FK026203F3VBQBV7V77V83&amp;JobNum=ACAD101624&amp;Resultsperpage=10&amp;lg=UK&amp;mask=uobext</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/45169/life-of-a-bioinformatician</guid>
	<pubDate>Fri, 15 May 2026 02:30:08 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/45169/life-of-a-bioinformatician</link>
	<title><![CDATA[Life of a Bioinformatician !]]></title>
	<description><![CDATA[<div><div><div><div><div><div><div dir="auto"><div><div><p>Somewhere between FASTQ files, volcano plots, and 3 AM coffee&hellip; the gene is probably hiding too.</p><p>#Bioinformatics #Genomics #ResearchL</p></div></div></div></div></div></div></div></div></div>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/45169" length="2686336" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36603/learning-python-programming-a-bioinformatician-perspective</guid>
	<pubDate>Mon, 14 May 2018 16:33:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36603/learning-python-programming-a-bioinformatician-perspective</link>
	<title><![CDATA[Learning Python Programming - a bioinformatician perspective !]]></title>
	<description><![CDATA[<p>Python Programming&nbsp;is a general purpose programming language that is open source, flexible, powerful and easy to use. One of the most important features of python is its rich set of utilities and libraries for data processing and analytics tasks. In the current era of big biological data, python and biopython is getting more popularity due to its easy-to-use features which supports big data processing.</p><p>In this tutorial series article, I will explore features and packages of python which are widely used in the big data, NGS, and bioinformatics. I will also walk through a real biological example which shows NGS data processing with the help of python packages and programming.</p><p>Python has a couple of points to recommend it to biologists and scientists specifically:</p><ul>
<li>It's widely used in the scientific community</li>
<li>It has a couple of very well designed libraries for doing complex scientific computing (although we won't encounter them in this book)</li>
<li>It lend itself well to being integrated with other, existing tools</li>
<li>It has features which make it easy to manipulate strings of characters (for example, strings of DNA bases and protein amino acid residues, which we as biologists are particularly fond of)</li>
</ul><p>In general, following are some of the important features of python which makes it a perfect fit for rapid application development.</p><ul>
<li>Python is interpreted language so the program does not need to be compiled. Interpreter parses the program code and generates the output.</li>
<li>Python is dynamically typed, so the variables types are defined automatically.</li>
<li>Python is strongly typed. So the developers need to cast the type manually.</li>
<li>Less code and more use makes it more acceptable.</li>
<li>Python is portable, extendable and scalable.</li>
</ul><p>There are two major Python versions, Python 2 and Python 3. Python 2 and 3 are quite different. This tutorial uses Python 3, because it more semantically correct and supports newer features.</p><p>I will post tutorial on daily basis on this page. Check the sub-pages on right side.</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/2534/bioinformatician-needs-ten-heads</guid>
	<pubDate>Sat, 17 Aug 2013 10:30:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/2534/bioinformatician-needs-ten-heads</link>
	<title><![CDATA[Bioinformatician needs ten heads !!!]]></title>
	<description><![CDATA[<p>Bioinformatics demands more and ... lots more knowledge. In this case Ravan, a mythological character from the Ramayan, can only be a real bioinformatician. :) :P</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/2534" length="90547" type="image/jpeg" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/4482/bioinformatics-definitions-and-applications</guid>
	<pubDate>Thu, 12 Sep 2013 15:04:36 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/4482/bioinformatics-definitions-and-applications</link>
	<title><![CDATA[Bioinformatics definitions and applications !!!]]></title>
	<description><![CDATA[<p>There have been long discussion amongst several specialized/expert educator regarding bioinformatics arena, but everyone explain bioinformatics with their own view. I tried to explain it with a cartoon. Hope you all will like it.</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/4482" length="49464" type="image/gif" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/7032/computer-experts-in-biotechnology-laboratory</guid>
	<pubDate>Wed, 04 Dec 2013 02:11:43 -0600</pubDate>
	<link>https://bioinformaticsonline.com/file/view/7032/computer-experts-in-biotechnology-laboratory</link>
	<title><![CDATA[Computer experts in biotechnology laboratory]]></title>
	<description><![CDATA[<p>Only bioinformatician can understand that <strong>multiplication</strong> and <strong>division</strong> are different but same thing :)</p><p><span>Disclaimer:</span>&nbsp;This cartoon is solely designed to create humour and fun, not to offend any computer experts.</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/7032" length="35726" type="image/gif" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/14302/bioinformatician-at-work</guid>
	<pubDate>Sat, 23 Aug 2014 04:44:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/14302/bioinformatician-at-work</link>
	<title><![CDATA[Bioinformatician at work !!!]]></title>
	<description><![CDATA[<p>Yet another peep up view of a bioinformatician research laboratory ...</p>]]></description>
	<dc:creator>Neel</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/14302" length="232751" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/2741/bioinformatician-dreams</guid>
	<pubDate>Wed, 21 Aug 2013 10:50:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/2741/bioinformatician-dreams</link>
	<title><![CDATA[Bioinformatician Dreams]]></title>
	<description><![CDATA[<p>Bioinformatician life is interconnected, they always dream for a powerful server, little more space on server as they are generating lots of data per run, dream to publish results in good impact journals, meetings reminders :) and research analysis off course!!!&nbsp;</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/2741" length="557537" type="image/png" />
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/41905/research-associate-bioinformatics-in-iisc-recruitment-2020</guid>
  <pubDate>Tue, 23 Jun 2020 21:53:34 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Associate Bioinformatics in IISc Recruitment 2020]]></title>
  <description><![CDATA[
<p>Research Associate Bioinformatics in IISc Recruitment 2020</p>

<p>Essential Qualifications: Ph.D. (Bioinformatics/ Biophysics/ Biotechnology or any other stream of biological/ physical sciences) with a minimum of two publications in reputed peer reviewed journals in the area of structural bioinformatics or biophysics or biomolecular modeling/ simulation.</p>

<p>Job description: Development of bioinformatics tools and algorithms/software for structure based analysis of biomolecular systems. Programmatic access to major biomolecular databases using APIs Knowledge based prediction and analysis of biomolecular structure, function and interactions. Docking/simulations for inhibitor design.</p>

<p>Desirable Qualifications (Research Associate/s): i)  Strong computer programming skills (in Python/PERL/PHP or C++ or object oriented database management systems like MySQL etc or scripting languages under LINUX/UNIX environment). </p>

<p>ii) Extensive experience in computational analysis of biomolecular structure/interactions and usage of advanced biomolecular simulation softwares. iii) Adequate knowledge of major databases, webservers and softwares in the area of biomolecular structure/function and drug design. iv)  Familiarity with Parallel Programming environments and experience in usage of high-end HPC clusters.</p>

<p>The candidates must highlight their experience in above mentioned fields/topics in their CV. Initial appointment will be for a period of 1 year, subject to extension after review of performance.</p>

<p>Emoluments: As per DST, GOI norms and commensurate with experience.</p>

<p>More at https://www.iisc.ac.in/positions-open/</p>
]]></description>
</item>

</channel>
</rss>