<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/42877?offset=0</link>
	<atom:link href="https://bioinformaticsonline.com/related/42877?offset=0" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/24042/research-associate-bioinformatician-university-of-bristol</guid>
  <pubDate>Wed, 26 Aug 2015 05:46:29 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Associate Bioinformatician @ University of Bristol]]></title>
  <description><![CDATA[
<p>This 0.5 fte role will have specific responsibility for the bioinformatic side of a Health Innovation Challenged Fund (HICF) research project investigating the application of Next Generation Sequencing (NGS) technologies to the analysis of Minimal Residual Disease (MRD) in childhood Acute Lymphoblastic Leukaemia (ALL). The successful candidate will be responsible for designing and implementing an analysis pipeline primarily to fit with the clinical need, but with the capacity to answer innovative research questions.</p>

<p>For informal enquiries please contact Anne Walsh via email: anne.walsh@bristol.ac.uk.</p>

<p>Apply at http://www.bris.ac.uk/jobs/find/details.html?nPostingID=3639&amp;nPostingTargetID=13346&amp;option=28&amp;sort=DESC&amp;respnr=1&amp;ID=Q50FK026203F3VBQBV7V77V83&amp;JobNum=ACAD101624&amp;Resultsperpage=10&amp;lg=UK&amp;mask=uobext</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/45169/life-of-a-bioinformatician</guid>
	<pubDate>Fri, 15 May 2026 02:30:08 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/45169/life-of-a-bioinformatician</link>
	<title><![CDATA[Life of a Bioinformatician !]]></title>
	<description><![CDATA[<div><div><div><div><div><div><div dir="auto"><div><div><p>Somewhere between FASTQ files, volcano plots, and 3 AM coffee&hellip; the gene is probably hiding too.</p><p>#Bioinformatics #Genomics #ResearchL</p></div></div></div></div></div></div></div></div></div>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/45169" length="2686336" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36603/learning-python-programming-a-bioinformatician-perspective</guid>
	<pubDate>Mon, 14 May 2018 16:33:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36603/learning-python-programming-a-bioinformatician-perspective</link>
	<title><![CDATA[Learning Python Programming - a bioinformatician perspective !]]></title>
	<description><![CDATA[<p>Python Programming&nbsp;is a general purpose programming language that is open source, flexible, powerful and easy to use. One of the most important features of python is its rich set of utilities and libraries for data processing and analytics tasks. In the current era of big biological data, python and biopython is getting more popularity due to its easy-to-use features which supports big data processing.</p><p>In this tutorial series article, I will explore features and packages of python which are widely used in the big data, NGS, and bioinformatics. I will also walk through a real biological example which shows NGS data processing with the help of python packages and programming.</p><p>Python has a couple of points to recommend it to biologists and scientists specifically:</p><ul>
<li>It's widely used in the scientific community</li>
<li>It has a couple of very well designed libraries for doing complex scientific computing (although we won't encounter them in this book)</li>
<li>It lend itself well to being integrated with other, existing tools</li>
<li>It has features which make it easy to manipulate strings of characters (for example, strings of DNA bases and protein amino acid residues, which we as biologists are particularly fond of)</li>
</ul><p>In general, following are some of the important features of python which makes it a perfect fit for rapid application development.</p><ul>
<li>Python is interpreted language so the program does not need to be compiled. Interpreter parses the program code and generates the output.</li>
<li>Python is dynamically typed, so the variables types are defined automatically.</li>
<li>Python is strongly typed. So the developers need to cast the type manually.</li>
<li>Less code and more use makes it more acceptable.</li>
<li>Python is portable, extendable and scalable.</li>
</ul><p>There are two major Python versions, Python 2 and Python 3. Python 2 and 3 are quite different. This tutorial uses Python 3, because it more semantically correct and supports newer features.</p><p>I will post tutorial on daily basis on this page. Check the sub-pages on right side.</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/2534/bioinformatician-needs-ten-heads</guid>
	<pubDate>Sat, 17 Aug 2013 10:30:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/2534/bioinformatician-needs-ten-heads</link>
	<title><![CDATA[Bioinformatician needs ten heads !!!]]></title>
	<description><![CDATA[<p>Bioinformatics demands more and ... lots more knowledge. In this case Ravan, a mythological character from the Ramayan, can only be a real bioinformatician. :) :P</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/2534" length="90547" type="image/jpeg" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/4482/bioinformatics-definitions-and-applications</guid>
	<pubDate>Thu, 12 Sep 2013 15:04:36 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/4482/bioinformatics-definitions-and-applications</link>
	<title><![CDATA[Bioinformatics definitions and applications !!!]]></title>
	<description><![CDATA[<p>There have been long discussion amongst several specialized/expert educator regarding bioinformatics arena, but everyone explain bioinformatics with their own view. I tried to explain it with a cartoon. Hope you all will like it.</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/4482" length="49464" type="image/gif" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/7032/computer-experts-in-biotechnology-laboratory</guid>
	<pubDate>Wed, 04 Dec 2013 02:11:43 -0600</pubDate>
	<link>https://bioinformaticsonline.com/file/view/7032/computer-experts-in-biotechnology-laboratory</link>
	<title><![CDATA[Computer experts in biotechnology laboratory]]></title>
	<description><![CDATA[<p>Only bioinformatician can understand that <strong>multiplication</strong> and <strong>division</strong> are different but same thing :)</p><p><span>Disclaimer:</span>&nbsp;This cartoon is solely designed to create humour and fun, not to offend any computer experts.</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/7032" length="35726" type="image/gif" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/10415/bioinformatician-stuck-in-wet-lab</guid>
	<pubDate>Tue, 06 May 2014 12:46:56 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/10415/bioinformatician-stuck-in-wet-lab</link>
	<title><![CDATA[Bioinformatician stuck in wet-lab]]></title>
	<description><![CDATA[<p>This guide is aimed at pet bioinformaticians, and is meant to guide them towards better career development.</p>
<p><strong>1. Make friends with local bioinformatics groups</strong><br> <strong>2. Talk to your computing group</strong><br> <strong>3. Obtain clear expectations</strong><br> <strong>4. Rewrite your job description</strong><br> <strong>5. Papers</strong><br> <strong>6. Attend bioinformatics meetings</strong><br> <strong>7. Try first, ask later</strong></p><p>Address of the bookmark: <a href="http://biomickwatson.wordpress.com/2013/04/23/a-guide-for-the-lonely-bioinformatician/" rel="nofollow">http://biomickwatson.wordpress.com/2013/04/23/a-guide-for-the-lonely-bioinformatician/</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/22995/bioinformatics-phd-postdoc-job-rejection</guid>
	<pubDate>Thu, 02 Jul 2015 08:52:46 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/22995/bioinformatics-phd-postdoc-job-rejection</link>
	<title><![CDATA[Bioinformatics PhD / PostDoc / Job Rejection]]></title>
	<description><![CDATA[<div><p>While your PhD or PostDoc application, it is more common that you got rejected by many professors. Don't disappoint reply it calmly.</p><p><img src="http://bioinformaticsonline.com/mod/photo/rejected1.png" alt="image" style="border: 0px; border: 0px;"></p><p>In grad school, I shared a house with three Bioinformatics PhD students. One, when he applied to a particular professor, received a letter that said, essentially, "If you are applying because you want to enrich yourself, great. If you are applying because you want a job, you should know that you won't get one." I am trying to tell you this is because if you, with a good background in Bioinformatics, are passing up opportunities, you must be a strong candidate in many areas. Enrich yourself.<br /><br /> So, my suggestion is take a deep breath, forgot about all. Don&rsquo;t take it personally. It's been usual processes while hunting for a good lab and professor. Take is positive, I am not sure why they reject, but don't worry perhaps the lab don't deserve you. Always remember there are billions of reasons not to hire someone for projects, especially in a research sector.<br /><br /> My suggestion, please do not whine about how you were a great research candidate for the post, and you just can't understand why they were so stupid as to have rejected you! This feeling will not win you any points in research, community. Especially, when in todays socially connected era everyone is linked. Remember, a nice E-mail saying, "I really wished to working with you on this project and I hope we cross paths again," is all you need to send to the professor. Send a thank you note to the professor. Thank them for the time they spend to judge you. In the future, If you and the professor (of your dream) are attending a bioinformatics conference, invite him/her to lunch (please remember to pay the bill). In today evolving scientific ere, always remember to build your solid network in order to get a job of interest. Join all possible networking sites like LinkedIn, ResearchGate, Acamedia, FB for the same reason. You as a researcher always build a bridge with student/researcher/colleague/professor who have the research potential to lead in research and hire you. Just because you didn't get this project, doesn't mean there isn't another that will open up in couple of month.<br /><br /> Mostly, jobs that are hard to get are hard to get. Only you can decide if the continued sacrifices are worth the expected payout. If it is, keep on plowing. Build relationships. Attend conferences.</p><p>Image ref @ JaSonYa</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/14302/bioinformatician-at-work</guid>
	<pubDate>Sat, 23 Aug 2014 04:44:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/14302/bioinformatician-at-work</link>
	<title><![CDATA[Bioinformatician at work !!!]]></title>
	<description><![CDATA[<p>Yet another peep up view of a bioinformatician research laboratory ...</p>]]></description>
	<dc:creator>Neel</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/14302" length="232751" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

</channel>
</rss>