<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/42877?offset=0</link>
	<atom:link href="https://bioinformaticsonline.com/related/42877?offset=0" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/27463/bpipe-a-tool-for-running-and-managing-bioinformatics-pipelines</guid>
	<pubDate>Sat, 21 May 2016 22:42:16 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/27463/bpipe-a-tool-for-running-and-managing-bioinformatics-pipelines</link>
	<title><![CDATA[Bpipe - a tool for running and managing bioinformatics pipelines]]></title>
	<description><![CDATA[<p>Bpipe provides a platform for running big bioinformatics jobs that consist of a series of processing stages - known as 'pipelines'.</p>
<ul>
<li>January 20th, 2016 - New! Bpipe 0.9.9 released!</li>
<li>Download <a href="http://download.bpipe.org/versions/bpipe-0.9.9.tar.gz">latest</a>, <a href="http://download.bpipe.org">all</a></li>
<li><a href="http://docs.bpipe.org">Documentation</a></li>
<li><a href="https://groups.google.com/forum/#%21forum/bpipe-discuss">Mailing List</a> (Google Group)</li>
</ul>
<p>Bpipe has been published in <a href="http://bioinformatics.oxfordjournals.org/content/early/2012/04/11/bioinformatics.bts167.abstract">Bioinformatics</a>! If you use Bpipe, please cite:</p>
<p><em>Sadedin S, Pope B &amp; Oshlack A, Bpipe: A Tool for Running and Managing Bioinformatics Pipelines, Bioinformatics</em></p><p>Address of the bookmark: <a href="http://docs.bpipe.org/" rel="nofollow">http://docs.bpipe.org/</a></p>]]></description>
	<dc:creator>Radha Agarkar</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/24042/research-associate-bioinformatician-university-of-bristol</guid>
  <pubDate>Wed, 26 Aug 2015 05:46:29 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Associate Bioinformatician @ University of Bristol]]></title>
  <description><![CDATA[
<p>This 0.5 fte role will have specific responsibility for the bioinformatic side of a Health Innovation Challenged Fund (HICF) research project investigating the application of Next Generation Sequencing (NGS) technologies to the analysis of Minimal Residual Disease (MRD) in childhood Acute Lymphoblastic Leukaemia (ALL). The successful candidate will be responsible for designing and implementing an analysis pipeline primarily to fit with the clinical need, but with the capacity to answer innovative research questions.</p>

<p>For informal enquiries please contact Anne Walsh via email: anne.walsh@bristol.ac.uk.</p>

<p>Apply at http://www.bris.ac.uk/jobs/find/details.html?nPostingID=3639&amp;nPostingTargetID=13346&amp;option=28&amp;sort=DESC&amp;respnr=1&amp;ID=Q50FK026203F3VBQBV7V77V83&amp;JobNum=ACAD101624&amp;Resultsperpage=10&amp;lg=UK&amp;mask=uobext</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/44669/bioinformatician-at-qub-uk</guid>
  <pubDate>Tue, 01 Oct 2024 21:43:23 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatician at QUB, UK]]></title>
  <description><![CDATA[
<p>The post-holder will work under the direction of the Precision Medicine Centre of Excellence's (PMC) Bioinformatics lead and collaborate closely with the Scientific and Clinical leads. The primary responsibilities will be to develop, validate and maintain data analysis pipelines and algorithms that enable the comprehensive analysis of genomic information derived from cancer specimens, within the context of clinical studies. The PMC is an ISO 15189:2012 accredited medical laboratory (Ref 20634), providing an integrated cancer diagnostic and clinical research service that combines high throughput genomics and digital pathology (www.qub.ac.uk/research-centres/PMC).</p>

<p>About the person:</p>

<p>Essential criteria:</p>

<p>Hold or be about to obtain* a PhD in Computational biology, Bioinformatics, computing science or related subjects. (*must be obtained within 3 months of the closing date for the post) or MSc equivalent with at least 3 years' work experience in a relevant role.<br />Significant relevant research experience in genomics or work experience in a relevant technical/scientific role.<br />Significant experience in managing and analysing NGS data and other big data.<br />Experience in developing and maintaining analysis pipelines.<br />Experience working with Linux/UNIX environments.<br />Proficiency with python, bash, R and/or equivalent languages.<br />To be successful at shortlisting stage, please ensure you clearly evidence in your application how you meet the essential and, where applicable, desirable criteria listed in the Candidate Information document linked on our website.</p>

<p>More at https://hrwebapp.qub.ac.uk/tlive_webrecruitment/wrd/run/ETREC107GF.open</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/2780/life-of-bi</guid>
	<pubDate>Thu, 22 Aug 2013 16:13:36 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/2780/life-of-bi</link>
	<title><![CDATA[Life of BI !!!]]></title>
	<description><![CDATA[<p>Hmm .. Don't worry you read it right .. this is not pi but bi ... "life of Bioinformatician(BI)".&nbsp;</p><p><span>Disclaimer:</span>&nbsp;This cartoon is solely designed to create humour and fun, not to offend any PI, supervisor or student.</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/2780" length="63826" type="image/jpeg" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/2383/golden-rules-of-bioinformatics</guid>
	<pubDate>Wed, 14 Aug 2013 21:11:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/2383/golden-rules-of-bioinformatics</link>
	<title><![CDATA[Golden Rules of Bioinformatics]]></title>
	<description><![CDATA[<ol>
<li>All constant are variable.</li>
<li>Copy and paste is a genetic error.</li>
<li>First solve the problem, then write the code.</li>
<li>No matter what goes wrong, it will probably look right.</li>
<li>Any simple problem can be insoluble if enough metting are held to discuss it. :P</li>
<li>Stastics is a systematic method of comming to the wrong conclusion with confidence.</li>
<li>Bug is a undocumented feature in programming languages.</li>
<li>Good biological programmer goes on summer holiday with raincoat. [because see 1]</li>
<li>Thanks god Google know python is not a python and multiplication and division are the same thing.</li>
<li>Don' be clever, complex biology will trick you.</li>
</ol>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/43292/bioinformatics-scientist-production-bioinformatics-south-san-francisco-ca</guid>
  <pubDate>Thu, 19 Aug 2021 08:45:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics Scientist, Production Bioinformatics @ South San Francisco, CA]]></title>
  <description><![CDATA[
<p>wist is looking for a Bioinformatics Scientist to join our Production Bioinformatics Team. You will work alongside research scientists, software engineers and data scientists to further deliver on our mission to expand access to best-in-class synthetic biology and next-generation sequencing applications. You will be developing and engineering tools to better evaluate and build hardened, production quality pipelines, optimize data quality, and automate lab and bioinformatics processes. Our ideal candidate is an organized problem solver with a background in developing and building novel production-quality bioinformatics tools and packages. Equally excellent communication skills and a proven ability to work independently are required.</p>

<p>More at https://boards.greenhouse.io/twistbioscience/jobs/3135495?gh_src=9ecc0b941us</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/23959/bioinformatics-jokes</guid>
	<pubDate>Fri, 21 Aug 2015 01:26:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/23959/bioinformatics-jokes</link>
	<title><![CDATA[Bioinformatics Jokes !!]]></title>
	<description><![CDATA[<p>Why was the Bioinformatics fired from his job?</p><p>A: He was getting too Sassy.</p><p>&nbsp;</p><p>What did the bioinformatician say when he found out his team stopped using version control?</p><p>A: Y&rsquo;all better Git!</p><p>&nbsp;</p><p>Why did the computational biologist stay home from work?</p><p>A: He had a code!</p><p>&nbsp;</p><p>Why was the bioinformatician's paper was rejected?</p><p>A: Journal thought it seemed scripted.</p><p>&nbsp;</p><p>How can you tell that a Bioinformatics is working?</p><p>A: You can hear him Grunting!</p><p>&nbsp;</p><p>Why bioinformatician always silence?</p><p>A: Because bioinformatician calmly whisper, &ldquo;SSH&rdquo;</p><p>&nbsp;</p><p>Why was the bioinformatician always so sleepy?</p><p>A: He/She wasn&rsquo;t given any Java.</p><p>&nbsp;</p><p>Why did the program/software hanged?</p><p>A: Because genome float.</p><p>&nbsp;</p><p>Why was the class upset that its parent died?</p><p>A: Because it wouldn&rsquo;t be getting the inheritance!</p><p>&nbsp;</p><p>Why did bioinformatician always works on the command line?</p><p>A: Because they don't want to scare you with huge amount of data!</p><p>&nbsp;</p><p>Why did the bioinformatician attend the gay pride parade?</p><p>A: They supported polymorphism.</p><p>&nbsp;</p><p>Why did bioinformatician prefer awk, PerlOneliner?</p><p>A: Because even computer can't handle to load the data.</p><p>&nbsp;</p><p>Why don&rsquo;t bioinformatician get along with others?</p><p>A: They&rsquo;re too MEAN.</p><p>&nbsp;</p><p>Why computational biologist are cool?</p><p>A: Because they are scripted!!</p><p>&nbsp;</p><p>Why they talk $ unzip; strip; touch; finger; grep; mount; fsck; more; yes; fsck; fsck; umount; clean; sleep;</p><p>A: Ah, Ohhh, dude, these are *NIX commands</p><p>&nbsp;</p><p>Did they really hack genome?</p><p>A: Yes, I guess so.</p>]]></description>
	<dc:creator>Jitendra Prajapati</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/14302/bioinformatician-at-work</guid>
	<pubDate>Sat, 23 Aug 2014 04:44:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/14302/bioinformatician-at-work</link>
	<title><![CDATA[Bioinformatician at work !!!]]></title>
	<description><![CDATA[<p>Yet another peep up view of a bioinformatician research laboratory ...</p>]]></description>
	<dc:creator>Neel</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/14302" length="232751" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

</channel>
</rss>