Perl one-liners are small and awesome Perl programs that fit in a single line of code and they do one thing really well. These things include changing line spacing, numbering lines, doing calculations, converting and substituting text, deleting and printing certain lines, parsing logs, editing files in-place, doing statistics, carrying out system administration tasks, updating a bunch of files at once, and many more. Perl one-liners will make you the shell warrior. Anything that took you minutes to solve, will now take you seconds!

perl -pe '$\="\n"'   
#double space a file

perl -pe '$_ .= "\n" unless /^$/'
#double space a file except blank lines

perl -pe '$_.="\n"x7'
#7 space in a line.

perl -ne 'print unless /^$/'
#remove all blank lines

perl -lne 'print if length($_) < 20'
#print all lines with length less than 20.

perl -00 -pe ''
#If there are multiple spaces, delete all leaving one(make the file a single spaced file).

perl -00 -pe '$_.="\n"x4'
#Expand single blank lines into 4 consecutive blank lines

perl -pe '$_ = "$. $_"'
#Number all lines in a file

perl -pe '$_ = ++$a." $_" if /./'
#Number only non-empty lines in a file

perl -ne 'print ++$a." $_" if /./'
#Number and print only non-empty lines in a file

perl -pe '$_ = ++$a." $_" if /regex/'
#Number only lines that match a pattern

perl -ne 'print ++$a." $_" if /regex/'
#Number and print only lines that match a pattern

perl -ne 'printf "%-5d %s", $., $_ if /regex/'
#Left align lines with 5 white spaces if matches a pattern (perl -ne 'printf "%-5d %s", $., $_' : for all the lines)

perl -le 'print scalar(grep{/./}<>)'
#prints the total number of non-empty lines in a file

perl -lne '$a++ if /regex/; END {print $a+0}'
#print the total number of lines that matches the pattern

perl -alne 'print scalar @F'
#print the total number fields(words) in each line.

perl -alne '$t += @F; END { print $t}'
#Find total number of words in the file

perl -alne 'map { /regex/ && $t++ } @F; END { print $t }'
#find total number of fields that match the pattern

perl -lne '/regex/ && $t++; END { print $t }'
#Find total number of lines that match a pattern

perl -le '$n = 20; $m = 35; ($m,$n) = ($n,$m%$n) while $n; print $m'
#will calculate the GCD of two numbers.

perl -le '$a = $n = 20; $b = $m = 35; ($m,$n) = ($n,$m%$n) while $n; print $a*$b/$m'
#will calculate lcd of 20 and 35.

perl -le '$n=10; $min=5; $max=15; $, = " "; print map { int(rand($max-$min))+$min } 1..$n'
#Generates 10 random numbers between 5 and 15.

perl -le 'print map { ("a".."z",”0”..”9”)[rand 36] } 1..8'
#Generates a 8 character password from a to z and number 0 – 9.

perl -le 'print map { ("a",”t”,”g”,”c”)[rand 4] } 1..20'
#Generates a 20 nucleotide long random residue.

perl -le 'print "a"x50'
#generate a string of ‘x’ 50 character long

perl -le 'print join ", ", map { ord } split //, "hello world"'
#Will print the ascii value of the string hello world.

perl -le '@ascii = (99, 111, 100, 105, 110, 103); print pack("C*", @ascii)'
#converts ascii values into character strings.

perl -le '@odd = grep {$_ % 2 == 1} 1..100; print "@odd"'
#Generates an array of odd numbers.

perl -le '@even = grep {$_ % 2 == 0} 1..100; print "@even"'
#Generate an array of even numbers

perl -lpe 'y/A-Za-z/N-ZA-Mn-za-m/' file
#Convert the entire file into 13 characters offset(ROT13)

perl -nle 'print uc'
#Convert all text to uppercase:

perl -nle 'print lc'
#Convert text to lowercase:

perl -nle 'print ucfirst lc'
#Convert only first letter of first word to uppercas

perl -ple 'y/A-Za-z/a-zA-Z/'
#Convert upper case to lower case and vice versa

perl -ple 's/(\w+)/\u$1/g'
#Camel Casing

perl -pe 's|\n|\r\n|'
#Convert unix new lines into DOS new lines:

perl -pe 's|\r\n|\n|'
#Convert DOS newlines into unix new line

perl -pe 's|\n|\r|'
#Convert unix newlines into MAC newlines:

perl -pe '/regexp/ && s/foo/bar/'
#Substitute a foo with a bar in a line with a regexp.

Reference/Sources:

http://genomics-array.blogspot.in/2010/11/some-unixperl-oneliners-for.html

http://genomespot.blogspot.com/2013/08/a-selection-of-useful-bash-one-liners.html

http://biowize.wordpress.com/2012/06/15/command-line-magic-for-your-gene-annotations/

http://genomics-array.blogspot.com/2010/11/some-unixperl-oneliners-for.html

http://bioexpressblog.wordpress.com/2013/04/05/split-multi-fasta-sequence-file/

#Find all occurrences of a pattern in a string.
#Given: Strings Pattern and Genome.
#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.

use strict;
use warnings;

my $string="GATATATGCATATACTT";
my $subStr="ATAT";
my $kmer=length($subStr);

kmerMatch ($string, $subStr, $kmer);

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
for (my $aa=0; $aa<=(length($string)-$kmer); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        print $aa;
    }
}
}

The next-generation sequencing included whole genome sequencing(WGS), transcriptome sequencing (whole cDNA sequencing, RNA-seq), digital gene expression sequencing (Tag-Seq), ChIP-Seq, and so on. And there are many sequencing platform to generate sequece, as well know Sanger/ABi(the frist generation), Solexa/illumina, SOLiD/ABi, 454/Roche. But thier sequence format is different, also they have different error type. High quality data is very important for further analysis or data mining. There are many pipeline for raw sequence quality analysis and control with few of process for reporting reads quality statistical details, trimming, filtering, and error correction. Please bookmarks them for the benefits of bioinformatics community.

https://code.google.com/p/biowiki/

https://code.google.com/p/ngs-pipeline/source/browse/#svn%2Ftrunk

NGSand Perl scripts https://code.google.com/hosting/search?q=NGS+perl&projectsearch=Search+projects

NGS and Python scripts https://code.google.com/hosting/search?q=NGS+Python&projectsearch=Search+projects

Address of the bookmark: https://code.google.com/hosting/search?q=bioinformatics&sa=Search

For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.

http://milkweedgenome.org/?q=scripts

Address of the bookmark: http://milkweedgenome.org/?q=scripts

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Originally design to map the location of objects in a 10 km map IrishGrid includes:

• native support of the Irish Grid System (see http://www.osi.ie/)
• optimize for speed (there's as less as possible data to conversion)
• customized color functions

https://code.google.com/p/irishgrid/downloads/detail?name=irishgrid.pl

Address of the bookmark: https://code.google.com/p/irishgrid/

#Find the reverse complement of a DNA string.
#Given: A DNA string Pattern.
#Return: Pattern, the reverse complement of Pattern.

use strict;
use warnings;

my $string="AAAACCCGGT";
my $finalString="";
my %hash = (
    "C" => "G",
    "A" => "T",
    "T" => "A",
    "G" => "C",
);

for (my $aa=0; $aa<=(length($string)-1); $aa++) {
    my $char=substr $string, $aa, 1;
    #print $hash{$char};
    $finalString="$hash{$char}"."$finalString";
}

print $finalString;
print "\n";

Bioinformatics Textbook Track

Find more about Rosalind puzzle at http://rosalind.info/problems/list-view/?location=bioinformatics-textbook-track

I will provide solution of all the Rosalind problem with Perl for community.

Check out the right sidebar for more links ...