BOL: Related items

Pattern Matching Problem Solution with Perl

Jit — Tue, 09 Jun 2015 23:58:45 -0500

Problem at http://rosalind.info/problems/1c/

#Find all occurrences of a pattern in a string.
#Given: Strings Pattern and Genome.
#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.

use strict;
use warnings;

my $string="GATATATGCATATACTT";
my $subStr="ATAT";
my $kmer=length($subStr);

kmerMatch ($string, $subStr, $kmer);

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
for (my $aa=0; $aa<=(length($string)-$kmer); $aa++) {
    my $myWin=substr $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        print $aa;
    }
}
}

BioScripts

Rahul Nayak — Sun, 28 Jun 2015 07:46:14 -0500

You are requested to please bookmark collection of bioinformatics tools, scripts, codes that can be pieced together in a very easy and flexible manner to perform both simple and complex bioinformatics tasks.

The next-generation sequencing included whole genome sequencing(WGS), transcriptome sequencing (whole cDNA sequencing, RNA-seq), digital gene expression sequencing (Tag-Seq), ChIP-Seq, and so on. And there are many sequencing platform to generate sequece, as well know Sanger/ABi(the frist generation), Solexa/illumina, SOLiD/ABi, 454/Roche. But thier sequence format is different, also they have different error type. High quality data is very important for further analysis or data mining. There are many pipeline for raw sequence quality analysis and control with few of process for reporting reads quality statistical details, trimming, filtering, and error correction. Please bookmarks them for the benefits of bioinformatics community.

https://code.google.com/p/biowiki/

https://code.google.com/p/ngs-pipeline/source/browse/#svn%2Ftrunk

NGSand Perl scripts https://code.google.com/hosting/search?q=NGS+perl&projectsearch=Search+projects

NGS and Python scripts https://code.google.com/hosting/search?q=NGS+Python&projectsearch=Search+projects

Address of the bookmark: https://code.google.com/hosting/search?q=bioinformatics&sa=Search

Rosalind Problem Solution with Perl

Jit — Tue, 09 Jun 2015 23:35:18 -0500

Rosalind is a platform for learning bioinformatics and programming through problem solving. Take a tour to get the hang of how Rosalind works.

Bioinformatics Textbook Track

Find more about Rosalind puzzle at http://rosalind.info/problems/list-view/?location=bioinformatics-textbook-track

I will provide solution of all the Rosalind problem with Perl for community.

Check out the right sidebar for more links ...

BioToolbox

Jit — Fri, 19 Feb 2016 09:14:44 -0600

This is a collection of libraries and high-quality end-user scripts for bioinformatic analysis, including working with gene annotation, collecting data scores from a variety of modern file formats, and conversion between file formats. The Bio::ToolBox libraries provide a unified, abstracted interface to multiple common gene annotation formats and the collection of data from multiple data files. They rely on BioPerl SeqFeature libraries and related adaptors to access binary file formats including Bam, BigWig, BigBed, and USeq. The Bio::ToolBox package includes scripts for setting up databases of annotation, collecting annotated features, collecting genomic data relative to features, manipulating and analyzing data, and data format conversion.

More at http://cpansearch.perl.org/src/TJPARNELL/

Address of the bookmark: http://cpansearch.perl.org/src/TJPARNELL/

VCFtools: perform common tasks with VCF files such as file validation, file merging, intersecting, complements

Rahul Nayak — Tue, 07 Aug 2018 10:01:46 -0500

VCFtools contains a Perl API (Vcf.pm) and a number of Perl scripts that can be used to perform common tasks with VCF files such as file validation, file merging, intersecting, complements, etc. The Perl tools support all versions of the VCF specification (3.2, 3.3, 4.0, 4.1 and 4.2), nevertheless, the users are encouraged to use the latest versions VCFv4.1 or VCFv4.2. The VCFtools in general have been used mainly with diploid data, but the Perl tools aim to support polyploid data as well. Run any of the Perl scripts with the --help switch to obtain more help.

Many of the Perl scripts require that the VCF files are compressed by bgzip and indexed by tabix (both tools are part of the tabix package, available for download here). The VCF files can be compressed and indexed using the following commands

bgzip my_file.vcf
tabix -p vcf my_file.vcf.gz

http://vcftools.sourceforge.net/perl_module.html

Address of the bookmark: http://vcftools.sourceforge.net/perl_module.html

MUM&Co is a simple bash script that uses Whole Genome Alignment information provided by MUMmer (v4) to detect variants.

Rahul Nayak — Wed, 27 Apr 2022 04:34:12 -0500

MUM&Co is able to detect:
Deletions, insertions, tandem duplications and tandem contractions (>=50bp & <=150kb)
Inversions (>=1kb) and translocations (>=10kb)

Address of the bookmark: https://github.com/SAMtoBAM/MUMandCo

Installing Bio::SCF perl module

Jit — Mon, 09 Apr 2018 04:04:29 -0500

Most Perl modules are written in Perl, some use XS (they are written in C) so require a C compiler (it's easy to get this setup - don't panic), see your OS of choice below to find out how to get the right compiler. Modules may have dependencies on other modules (almost always on CPAN) and cannot be installed without them (or without a specific version of them). Many modules on CPAN require a somewhat recent version of Perl (version 5.8 or above).

More about the basic perl module installation steps check this http://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways

installing Bio::SCF perl module is daunting task, specieally because of it dependencies. Here is the steps, you need to follow to sucessfully install Bio::SCF module

#sudo apt-get install libbio-scf-perl #trev for visualization of scf file

1. You will need the zlib library which can be found at http://www.zlib.net/.

install zlib library first:

jitendra@jitendra-UNLOCK-INSTALL[zlib-1.2.11] ./configure []
Checking for gcc...
Checking for shared library support...
Building shared library libz.so.1.2.11 with gcc.
Checking for size_t... Yes.
Checking for off64_t... Yes.
Checking for fseeko... Yes.
Checking for strerror... Yes.
Checking for unistd.h... Yes.
Checking for stdarg.h... Yes.
Checking whether to use vs[n]printf() or s[n]printf()... using vs[n]printf().
Checking for vsnprintf() in stdio.h... Yes.
Checking for return value of vsnprintf()... Yes.
Checking for attribute(visibility) support... Yes.
jitendra@jitendra-UNLOCK-INSTALL[zlib-1.2.11] make []
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -I. -c -o example.o test/example.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o adler32.o adler32.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o crc32.o crc32.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o deflate.o deflate.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o infback.o infback.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o inffast.o inffast.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o inflate.o inflate.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o inftrees.o inftrees.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o trees.o trees.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o zutil.o zutil.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o compress.o compress.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o uncompr.o uncompr.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o gzclose.o gzclose.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o gzlib.o gzlib.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o gzread.o gzread.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o gzwrite.o gzwrite.c
ar rc libz.a adler32.o crc32.o deflate.o infback.o inffast.o inflate.o inftrees.o trees.o zutil.o compress.o uncompr.o gzclose.o gzlib.o gzread.o gzwrite.o
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o example example.o -L. libz.a
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -I. -c -o minigzip.o test/minigzip.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o minigzip minigzip.o -L. libz.a
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/adler32.o adler32.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/crc32.o crc32.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/deflate.o deflate.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/infback.o infback.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/inffast.o inffast.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/inflate.o inflate.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/inftrees.o inftrees.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/trees.o trees.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/zutil.o zutil.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/compress.o compress.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/uncompr.o uncompr.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzclose.o gzclose.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzlib.o gzlib.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzread.o gzread.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzwrite.o gzwrite.c
gcc -shared -Wl,-soname,libz.so.1,--version-script,zlib.map -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o libz.so.1.2.11 adler32.lo crc32.lo deflate.lo infback.lo inffast.lo inflate.lo inftrees.lo trees.lo zutil.lo compress.lo uncompr.lo gzclose.lo gzlib.lo gzread.lo gzwrite.lo -lc
rm -f libz.so libz.so.1
ln -s libz.so.1.2.11 libz.so
ln -s libz.so.1.2.11 libz.so.1
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o examplesh example.o -L. libz.so.1.2.11
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o minigzipsh minigzip.o -L. libz.so.1.2.11
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -I. -D_FILE_OFFSET_BITS=64 -c -o example64.o test/example.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o example64 example64.o -L. libz.a
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -I. -D_FILE_OFFSET_BITS=64 -c -o minigzip64.o test/minigzip.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o minigzip64 minigzip64.o -L. libz.a
jitendra@jitendra-UNLOCK-INSTALL[zlib-1.2.11] sudo make install []
[sudo] password for jitendra:
rm -f /usr/local/lib/libz.a
cp libz.a /usr/local/lib
chmod 644 /usr/local/lib/libz.a
cp libz.so.1.2.11 /usr/local/lib
chmod 755 /usr/local/lib/libz.so.1.2.11
rm -f /usr/local/share/man/man3/zlib.3
cp zlib.3 /usr/local/share/man/man3
chmod 644 /usr/local/share/man/man3/zlib.3
rm -f /usr/local/lib/pkgconfig/zlib.pc
cp zlib.pc /usr/local/lib/pkgconfig
chmod 644 /usr/local/lib/pkgconfig/zlib.pc
rm -f /usr/local/include/zlib.h /usr/local/include/zconf.h
cp zlib.h zconf.h /usr/local/include
chmod 644 /usr/local/include/zlib.h /usr/local/include/zconf.h

2. Now make io_lib-1.9

In order to install this perl extension you have to install io-lib version 1.9 or higher from the Staden library (staden.sourceforge.net). This can be downloaded from https://sourceforge.net/project/showfiles.php?group_id=100316&package_id=108243&release_id=340318 confirm that the package installed correctly look for a library named "libread".

jitendra@jitendra-UNLOCK-INSTALL[io_lib-1.9.0] export CFLAGS="-fPIC" && ./configure
checking for a BSD-compatible install... /usr/bin/install -c
checking whether build environment is sane... yes
checking for gawk... gawk
checking whether make sets $(MAKE)... yes
checking for gcc... gcc
checking for C compiler default output file name... a.out
checking whether the C compiler works... yes
checking whether we are cross compiling... no
checking for suffix of executables...
checking for suffix of object files... o
checking whether we are using the GNU C compiler... yes
checking whether gcc accepts -g... yes
checking for gcc option to accept ANSI C... none needed
checking for style of include used by make... GNU
checking dependency style of gcc... gcc3
checking for a BSD-compatible install... /usr/bin/install -c
checking for ranlib... ranlib
checking for main in -lz... yes
checking how to run the C preprocessor... gcc -E
checking for egrep... grep -E
checking for ANSI C header files... yes
checking for sys/wait.h that is POSIX.1 compatible... yes
checking for sys/types.h... yes
checking for sys/stat.h... yes
checking for stdlib.h... yes
checking for string.h... yes
checking for memory.h... yes
checking for strings.h... yes
checking for inttypes.h... yes
checking for stdint.h... yes
checking for unistd.h... yes
checking fcntl.h usability... yes
checking fcntl.h presence... yes
checking for fcntl.h... yes
checking limits.h usability... yes
checking limits.h presence... yes
checking for limits.h... yes
checking for unistd.h... (cached) yes
checking zlib.h usability... yes
checking zlib.h presence... yes
checking for zlib.h... yes
checking whether byte ordering is bigendian... no
checking for short... yes
checking size of short... 2
checking for int... yes
checking size of int... 4
checking for long... yes
checking size of long... 8
checking for inline... inline
checking for mode_t... yes
checking build system type... x86_64-unknown-linux-gnu
checking host system type... x86_64-unknown-linux-gnu
checking for cos in -lm... yes
checking for strdup... yes
configure: creating ./config.status
config.status: creating Makefile
config.status: creating read/Makefile
config.status: creating progs/Makefile
config.status: creating config.h
config.status: executing depfiles commands
jitendra@jitendra-UNLOCK-INSTALL[io_lib-1.9.0] make []
make all-recursive
make[1]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0'
Making all in read
make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/read'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT Read.o -MD -MP -MF ".deps/Read.Tpo" -c -o Read.o Read.c; \
then mv -f ".deps/Read.Tpo" ".deps/Read.Po"; else rm -f ".deps/Read.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT scf_extras.o -MD -MP -MF ".deps/scf_extras.Tpo" -c -o scf_extras.o scf_extras.c; \
then mv -f ".deps/scf_extras.Tpo" ".deps/scf_extras.Po"; else rm -f ".deps/scf_extras.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT translate.o -MD -MP -MF ".deps/translate.Tpo" -c -o translate.o translate.c; \
then mv -f ".deps/translate.Tpo" ".deps/translate.Po"; else rm -f ".deps/translate.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT compression.o -MD -MP -MF ".deps/compression.Tpo" -c -o compression.o `test -f '../ztr/compression.c' || echo './'`../ztr/compression.c; \
then mv -f ".deps/compression.Tpo" ".deps/compression.Po"; else rm -f ".deps/compression.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT ztr.o -MD -MP -MF ".deps/ztr.Tpo" -c -o ztr.o `test -f '../ztr/ztr.c' || echo './'`../ztr/ztr.c; \
then mv -f ".deps/ztr.Tpo" ".deps/ztr.Po"; else rm -f ".deps/ztr.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT ztr_translate.o -MD -MP -MF ".deps/ztr_translate.Tpo" -c -o ztr_translate.o `test -f '../ztr/ztr_translate.c' || echo './'`../ztr/ztr_translate.c; \
then mv -f ".deps/ztr_translate.Tpo" ".deps/ztr_translate.Po"; else rm -f ".deps/ztr_translate.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT fpoint.o -MD -MP -MF ".deps/fpoint.Tpo" -c -o fpoint.o `test -f '../abi/fpoint.c' || echo './'`../abi/fpoint.c; \
then mv -f ".deps/fpoint.Tpo" ".deps/fpoint.Po"; else rm -f ".deps/fpoint.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT seqIOABI.o -MD -MP -MF ".deps/seqIOABI.Tpo" -c -o seqIOABI.o `test -f '../abi/seqIOABI.c' || echo './'`../abi/seqIOABI.c; \
then mv -f ".deps/seqIOABI.Tpo" ".deps/seqIOABI.Po"; else rm -f ".deps/seqIOABI.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT seqIOALF.o -MD -MP -MF ".deps/seqIOALF.Tpo" -c -o seqIOALF.o `test -f '../alf/seqIOALF.c' || echo './'`../alf/seqIOALF.c; \
then mv -f ".deps/seqIOALF.Tpo" ".deps/seqIOALF.Po"; else rm -f ".deps/seqIOALF.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT ctfCompress.o -MD -MP -MF ".deps/ctfCompress.Tpo" -c -o ctfCompress.o `test -f '../ctf/ctfCompress.c' || echo './'`../ctf/ctfCompress.c; \
then mv -f ".deps/ctfCompress.Tpo" ".deps/ctfCompress.Po"; else rm -f ".deps/ctfCompress.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT seqIOCTF.o -MD -MP -MF ".deps/seqIOCTF.Tpo" -c -o seqIOCTF.o `test -f '../ctf/seqIOCTF.c' || echo './'`../ctf/seqIOCTF.c; \
then mv -f ".deps/seqIOCTF.Tpo" ".deps/seqIOCTF.Po"; else rm -f ".deps/seqIOCTF.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT expFileIO.o -MD -MP -MF ".deps/expFileIO.Tpo" -c -o expFileIO.o `test -f '../exp_file/expFileIO.c' || echo './'`../exp_file/expFileIO.c; \
then mv -f ".deps/expFileIO.Tpo" ".deps/expFileIO.Po"; else rm -f ".deps/expFileIO.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT seqIOPlain.o -MD -MP -MF ".deps/seqIOPlain.Tpo" -c -o seqIOPlain.o `test -f '../plain/seqIOPlain.c' || echo './'`../plain/seqIOPlain.c; \
then mv -f ".deps/seqIOPlain.Tpo" ".deps/seqIOPlain.Po"; else rm -f ".deps/seqIOPlain.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT misc_scf.o -MD -MP -MF ".deps/misc_scf.Tpo" -c -o misc_scf.o `test -f '../scf/misc_scf.c' || echo './'`../scf/misc_scf.c; \
then mv -f ".deps/misc_scf.Tpo" ".deps/misc_scf.Po"; else rm -f ".deps/misc_scf.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT read_scf.o -MD -MP -MF ".deps/read_scf.Tpo" -c -o read_scf.o `test -f '../scf/read_scf.c' || echo './'`../scf/read_scf.c; \
then mv -f ".deps/read_scf.Tpo" ".deps/read_scf.Po"; else rm -f ".deps/read_scf.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT write_scf.o -MD -MP -MF ".deps/write_scf.Tpo" -c -o write_scf.o `test -f '../scf/write_scf.c' || echo './'`../scf/write_scf.c; \
then mv -f ".deps/write_scf.Tpo" ".deps/write_scf.Po"; else rm -f ".deps/write_scf.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT array.o -MD -MP -MF ".deps/array.Tpo" -c -o array.o `test -f '../utils/array.c' || echo './'`../utils/array.c; \
then mv -f ".deps/array.Tpo" ".deps/array.Po"; else rm -f ".deps/array.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT compress.o -MD -MP -MF ".deps/compress.Tpo" -c -o compress.o `test -f '../utils/compress.c' || echo './'`../utils/compress.c; \
then mv -f ".deps/compress.Tpo" ".deps/compress.Po"; else rm -f ".deps/compress.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT error.o -MD -MP -MF ".deps/error.Tpo" -c -o error.o `test -f '../utils/error.c' || echo './'`../utils/error.c; \
then mv -f ".deps/error.Tpo" ".deps/error.Po"; else rm -f ".deps/error.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT files.o -MD -MP -MF ".deps/files.Tpo" -c -o files.o `test -f '../utils/files.c' || echo './'`../utils/files.c; \
then mv -f ".deps/files.Tpo" ".deps/files.Po"; else rm -f ".deps/files.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT find.o -MD -MP -MF ".deps/find.Tpo" -c -o find.o `test -f '../utils/find.c' || echo './'`../utils/find.c; \
then mv -f ".deps/find.Tpo" ".deps/find.Po"; else rm -f ".deps/find.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT mach-io.o -MD -MP -MF ".deps/mach-io.Tpo" -c -o mach-io.o `test -f '../utils/mach-io.c' || echo './'`../utils/mach-io.c; \
then mv -f ".deps/mach-io.Tpo" ".deps/mach-io.Po"; else rm -f ".deps/mach-io.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT open_trace_file.o -MD -MP -MF ".deps/open_trace_file.Tpo" -c -o open_trace_file.o `test -f '../utils/open_trace_file.c' || echo './'`../utils/open_trace_file.c; \
then mv -f ".deps/open_trace_file.Tpo" ".deps/open_trace_file.Po"; else rm -f ".deps/open_trace_file.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT read_alloc.o -MD -MP -MF ".deps/read_alloc.Tpo" -c -o read_alloc.o `test -f '../utils/read_alloc.c' || echo './'`../utils/read_alloc.c; \
then mv -f ".deps/read_alloc.Tpo" ".deps/read_alloc.Po"; else rm -f ".deps/read_alloc.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT strings.o -MD -MP -MF ".deps/strings.Tpo" -c -o strings.o `test -f '../utils/strings.c' || echo './'`../utils/strings.c; \
then mv -f ".deps/strings.Tpo" ".deps/strings.Po"; else rm -f ".deps/strings.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT traceType.o -MD -MP -MF ".deps/traceType.Tpo" -c -o traceType.o `test -f '../utils/traceType.c' || echo './'`../utils/traceType.c; \
then mv -f ".deps/traceType.Tpo" ".deps/traceType.Po"; else rm -f ".deps/traceType.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT xalloc.o -MD -MP -MF ".deps/xalloc.Tpo" -c -o xalloc.o `test -f '../utils/xalloc.c' || echo './'`../utils/xalloc.c; \
then mv -f ".deps/xalloc.Tpo" ".deps/xalloc.Po"; else rm -f ".deps/xalloc.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT vlen.o -MD -MP -MF ".deps/vlen.Tpo" -c -o vlen.o `test -f '../utils/vlen.c' || echo './'`../utils/vlen.c; \
then mv -f ".deps/vlen.Tpo" ".deps/vlen.Po"; else rm -f ".deps/vlen.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT hash_table.o -MD -MP -MF ".deps/hash_table.Tpo" -c -o hash_table.o `test -f '../utils/hash_table.c' || echo './'`../utils/hash_table.c; \
then mv -f ".deps/hash_table.Tpo" ".deps/hash_table.Po"; else rm -f ".deps/hash_table.Tpo"; exit 1; fi
../utils/hash_table.c: In function ‘HashFileOpen’:
../utils/hash_table.c:920:21: warning: field precision specifier ‘.*’ expects argument of type ‘int’, but argument 3 has type ‘long int’ [-Wformat=]
sprintf(aname, "%.*s%s", cp-fname+1, fname, hf->archive);
^
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT mFILE.o -MD -MP -MF ".deps/mFILE.Tpo" -c -o mFILE.o `test -f '../utils/mFILE.c' || echo './'`../utils/mFILE.c; \
then mv -f ".deps/mFILE.Tpo" ".deps/mFILE.Po"; else rm -f ".deps/mFILE.Tpo"; exit 1; fi
rm -f libread.a
ar cru libread.a Read.o scf_extras.o translate.o compression.o ztr.o ztr_translate.o fpoint.o seqIOABI.o seqIOALF.o ctfCompress.o seqIOCTF.o expFileIO.o seqIOPlain.o misc_scf.o read_scf.o write_scf.o array.o compress.o error.o files.o find.o mach-io.o open_trace_file.o read_alloc.o strings.o traceType.o xalloc.o vlen.o hash_table.o mFILE.o
ar: `u' modifier ignored since `D' is the default (see `U')
ranlib libread.a
make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/read'
Making all in progs
make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT convert_trace.o -MD -MP -MF ".deps/convert_trace.Tpo" -c -o convert_trace.o convert_trace.c; \
then mv -f ".deps/convert_trace.Tpo" ".deps/convert_trace.Po"; else rm -f ".deps/convert_trace.Tpo"; exit 1; fi
gcc -fPIC -o convert_trace convert_trace.o ../read/libread.a -lz -lm
../read/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT makeSCF.o -MD -MP -MF ".deps/makeSCF.Tpo" -c -o makeSCF.o makeSCF.c; \
then mv -f ".deps/makeSCF.Tpo" ".deps/makeSCF.Po"; else rm -f ".deps/makeSCF.Tpo"; exit 1; fi
gcc -fPIC -o makeSCF makeSCF.o ../read/libread.a -lz -lm
../read/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT extract_seq.o -MD -MP -MF ".deps/extract_seq.Tpo" -c -o extract_seq.o extract_seq.c; \
then mv -f ".deps/extract_seq.Tpo" ".deps/extract_seq.Po"; else rm -f ".deps/extract_seq.Tpo"; exit 1; fi
gcc -fPIC -o extract_seq extract_seq.o ../read/libread.a -lz -lm
../read/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT index_tar.o -MD -MP -MF ".deps/index_tar.Tpo" -c -o index_tar.o index_tar.c; \
then mv -f ".deps/index_tar.Tpo" ".deps/index_tar.Po"; else rm -f ".deps/index_tar.Tpo"; exit 1; fi
gcc -fPIC -o index_tar index_tar.o
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT scf_dump.o -MD -MP -MF ".deps/scf_dump.Tpo" -c -o scf_dump.o scf_dump.c; \
then mv -f ".deps/scf_dump.Tpo" ".deps/scf_dump.Po"; else rm -f ".deps/scf_dump.Tpo"; exit 1; fi
gcc -fPIC -o scf_dump scf_dump.o ../read/libread.a -lz -lm
../read/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT scf_info.o -MD -MP -MF ".deps/scf_info.Tpo" -c -o scf_info.o scf_info.c; \
then mv -f ".deps/scf_info.Tpo" ".deps/scf_info.Po"; else rm -f ".deps/scf_info.Tpo"; exit 1; fi
gcc -fPIC -o scf_info scf_info.o ../read/libread.a -lz -lm
../read/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT scf_update.o -MD -MP -MF ".deps/scf_update.Tpo" -c -o scf_update.o scf_update.c; \
then mv -f ".deps/scf_update.Tpo" ".deps/scf_update.Po"; else rm -f ".deps/scf_update.Tpo"; exit 1; fi
gcc -fPIC -o scf_update scf_update.o ../read/libread.a -lz -lm
../read/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT get_comment.o -MD -MP -MF ".deps/get_comment.Tpo" -c -o get_comment.o get_comment.c; \
then mv -f ".deps/get_comment.Tpo" ".deps/get_comment.Po"; else rm -f ".deps/get_comment.Tpo"; exit 1; fi
gcc -fPIC -o get_comment get_comment.o ../read/libread.a -lz -lm
../read/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT hash_tar.o -MD -MP -MF ".deps/hash_tar.Tpo" -c -o hash_tar.o hash_tar.c; \
then mv -f ".deps/hash_tar.Tpo" ".deps/hash_tar.Po"; else rm -f ".deps/hash_tar.Tpo"; exit 1; fi
gcc -fPIC -o hash_tar hash_tar.o ../read/libread.a -lz -lm
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT hash_extract.o -MD -MP -MF ".deps/hash_extract.Tpo" -c -o hash_extract.o hash_extract.c; \
then mv -f ".deps/hash_extract.Tpo" ".deps/hash_extract.Po"; else rm -f ".deps/hash_extract.Tpo"; exit 1; fi
gcc -fPIC -o hash_extract hash_extract.o ../read/libread.a -lz -lm
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT trace_dump.o -MD -MP -MF ".deps/trace_dump.Tpo" -c -o trace_dump.o trace_dump.c; \
then mv -f ".deps/trace_dump.Tpo" ".deps/trace_dump.Po"; else rm -f ".deps/trace_dump.Tpo"; exit 1; fi
gcc -fPIC -o trace_dump trace_dump.o ../read/libread.a -lz -lm
../read/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'
make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0'
make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0'
make[1]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0'

jitendra@jitendra-UNLOCK-INSTALL[io_lib-1.9.0] sudo make install []
[sudo] password for jitendra:
Making install in read
make[1]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/read'
make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/read'
test -z "/usr/local/lib" || mkdir -p -- "/usr/local/lib"
/usr/bin/install -c -m 644 'libread.a' '/usr/local/lib/libread.a'
ranlib '/usr/local/lib/libread.a'
make[2]: Nothing to be done for 'install-data-am'.
make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/read'
make[1]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/read'
Making install in progs
make[1]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'
make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'
test -z "/usr/local/bin" || mkdir -p -- "/usr/local/bin"
/usr/bin/install -c 'convert_trace' '/usr/local/bin/convert_trace'
/usr/bin/install -c 'makeSCF' '/usr/local/bin/makeSCF'
/usr/bin/install -c 'extract_seq' '/usr/local/bin/extract_seq'
/usr/bin/install -c 'index_tar' '/usr/local/bin/index_tar'
/usr/bin/install -c 'scf_dump' '/usr/local/bin/scf_dump'
/usr/bin/install -c 'scf_info' '/usr/local/bin/scf_info'
/usr/bin/install -c 'scf_update' '/usr/local/bin/scf_update'
/usr/bin/install -c 'get_comment' '/usr/local/bin/get_comment'
/usr/bin/install -c 'hash_tar' '/usr/local/bin/hash_tar'
/usr/bin/install -c 'hash_extract' '/usr/local/bin/hash_extract'
/usr/bin/install -c 'trace_dump' '/usr/local/bin/trace_dump'
make[2]: Nothing to be done for 'install-data-am'.
make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'
make[1]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'
make[1]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0'
make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0'
make[2]: Nothing to be done for 'install-exec-am'.
test -z "/usr/local/man/man3" || mkdir -p -- "/usr/local/man/man3"
/usr/bin/install -c -m 644 './man/man3/exp2read.3' '/usr/local/man/man3/exp2read.3'
/usr/bin/install -c -m 644 './man/man3/ExperimentFile.3' '/usr/local/man/man3/ExperimentFile.3'
/usr/bin/install -c -m 644 './man/man3/fread_reading.3' '/usr/local/man/man3/fread_reading.3'
/usr/bin/install -c -m 644 './man/man3/fread_scf.3' '/usr/local/man/man3/fread_scf.3'
/usr/bin/install -c -m 644 './man/man3/fwrite_reading.3' '/usr/local/man/man3/fwrite_reading.3'
/usr/bin/install -c -m 644 './man/man3/fwrite_scf.3' '/usr/local/man/man3/fwrite_scf.3'
/usr/bin/install -c -m 644 './man/man3/read2exp.3' '/usr/local/man/man3/read2exp.3'
/usr/bin/install -c -m 644 './man/man3/read2scf.3' '/usr/local/man/man3/read2scf.3'
/usr/bin/install -c -m 644 './man/man3/read_allocate.3' '/usr/local/man/man3/read_allocate.3'
/usr/bin/install -c -m 644 './man/man3/read_deallocate.3' '/usr/local/man/man3/read_deallocate.3'
/usr/bin/install -c -m 644 './man/man3/read_reading.3' '/usr/local/man/man3/read_reading.3'
/usr/bin/install -c -m 644 './man/man3/read_scf.3' '/usr/local/man/man3/read_scf.3'
/usr/bin/install -c -m 644 './man/man3/read_scf_header.3' '/usr/local/man/man3/read_scf_header.3'
/usr/bin/install -c -m 644 './man/man3/scf2read.3' '/usr/local/man/man3/scf2read.3'
/usr/bin/install -c -m 644 './man/man3/write_reading.3' '/usr/local/man/man3/write_reading.3'
/usr/bin/install -c -m 644 './man/man3/write_scf.3' '/usr/local/man/man3/write_scf.3'
/usr/bin/install -c -m 644 './man/man3/write_scf_header.3' '/usr/local/man/man3/write_scf_header.3'
test -z "/usr/local/man/man4" || mkdir -p -- "/usr/local/man/man4"
/usr/bin/install -c -m 644 './man/man4/Read.4' '/usr/local/man/man4/Read.4'
test -z "/usr/local/include/io_lib" || mkdir -p -- "/usr/local/include/io_lib"
/usr/bin/install -c -m 644 'read/Read.h' '/usr/local/include/io_lib/Read.h'
/usr/bin/install -c -m 644 'read/scf_extras.h' '/usr/local/include/io_lib/scf_extras.h'
/usr/bin/install -c -m 644 'read/translate.h' '/usr/local/include/io_lib/translate.h'
/usr/bin/install -c -m 644 'abi/abi.h' '/usr/local/include/io_lib/abi.h'
/usr/bin/install -c -m 644 'abi/fpoint.h' '/usr/local/include/io_lib/fpoint.h'
/usr/bin/install -c -m 644 'abi/seqIOABI.h' '/usr/local/include/io_lib/seqIOABI.h'
/usr/bin/install -c -m 644 'alf/alf.h' '/usr/local/include/io_lib/alf.h'
/usr/bin/install -c -m 644 'ctf/seqIOCTF.h' '/usr/local/include/io_lib/seqIOCTF.h'
/usr/bin/install -c -m 644 'exp_file/expFileIO.h' '/usr/local/include/io_lib/expFileIO.h'
/usr/bin/install -c -m 644 'plain/plain.h' '/usr/local/include/io_lib/plain.h'
/usr/bin/install -c -m 644 'scf/scf.h' '/usr/local/include/io_lib/scf.h'
/usr/bin/install -c -m 644 'utils/array.h' '/usr/local/include/io_lib/array.h'
/usr/bin/install -c -m 644 'utils/compress.h' '/usr/local/include/io_lib/compress.h'
/usr/bin/install -c -m 644 'utils/error.h' '/usr/local/include/io_lib/error.h'
/usr/bin/install -c -m 644 'utils/mach-io.h' '/usr/local/include/io_lib/mach-io.h'
/usr/bin/install -c -m 644 'utils/misc.h' '/usr/local/include/io_lib/misc.h'
/usr/bin/install -c -m 644 'utils/open_trace_file.h' '/usr/local/include/io_lib/open_trace_file.h'
/usr/bin/install -c -m 644 'utils/tar_format.h' '/usr/local/include/io_lib/tar_format.h'
/usr/bin/install -c -m 644 'utils/traceType.h' '/usr/local/include/io_lib/traceType.h'
/usr/bin/install -c -m 644 'utils/xalloc.h' '/usr/local/include/io_lib/xalloc.h'
/usr/bin/install -c -m 644 'utils/mFILE.h' '/usr/local/include/io_lib/mFILE.h'
/usr/bin/install -c -m 644 'utils/stdio_hack.h' '/usr/local/include/io_lib/stdio_hack.h'
/usr/bin/install -c -m 644 'utils/vlen.h' '/usr/local/include/io_lib/vlen.h'
/usr/bin/install -c -m 644 'utils/hash_table.h' '/usr/local/include/io_lib/hash_table.h'
/usr/bin/install -c -m 644 'utils/os.h' '/usr/local/include/io_lib/os.h'
/usr/bin/install -c -m 644 'ztr/compression.h' '/usr/local/include/io_lib/compression.h'
/usr/bin/install -c -m 644 'ztr/ztr.h' '/usr/local/include/io_lib/ztr.h'
make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0'
make[1]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0'

3. Now install Bio::SCF

Now follows these steps:

tar zxf Bio::SCF.tar
cd Bio::SCF
perl Makefile.PL
make
make test
make install

jitendra@jitendra-UNLOCK-INSTALL[Bio-SCF-1.01] perl Makefile.PL []
Checking if your kit is complete...
Looks good
Generating a Unix-style Makefile
Writing Makefile for Bio::SCF
Writing MYMETA.yml and MYMETA.json
jitendra@jitendra-UNLOCK-INSTALL[Bio-SCF-1.01] make []
cp SCF.pm blib/lib/Bio/SCF.pm
cp SCF/Arrays.pm blib/lib/Bio/SCF/Arrays.pm
Running Mkbootstrap for Bio::SCF ()
chmod 644 "SCF.bs"
"/usr/bin/perl" "/usr/share/perl/5.22/ExtUtils/xsubpp" -typemap "/usr/share/perl/5.22/ExtUtils/typemap" SCF.xs > SCF.xsc && mv SCF.xsc SCF.c
Please specify prototyping behavior for SCF.xs (see perlxs manual)
x86_64-linux-gnu-gcc -c -D_REENTRANT -D_GNU_SOURCE -DDEBIAN -fwrapv -fno-strict-aliasing -pipe -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -g -DVERSION=\"1.01\" -DXS_VERSION=\"1.01\" -fPIC "-I/usr/lib/x86_64-linux-gnu/perl/5.22/CORE" -DLITTLE_ENDIAN SCF.c
In file included from /usr/lib/x86_64-linux-gnu/perl/5.22/CORE/perl.h:5546:0,
from SCF.xs:5:
SCF.xs: In function ‘XS_Bio__SCF_get_scf_pointer’:
SCF.xs:57:20: warning: cast from pointer to integer of different size [-Wpointer-to-int-cast]
ret_val = newSViv((int)scf_data);
^
/usr/lib/x86_64-linux-gnu/perl/5.22/CORE/embed.h:402:40: note: in definition of macro ‘newSViv’
#define newSViv(a) Perl_newSViv(aTHX_ a)
^
SCF.xs: In function ‘XS_Bio__SCF_get_scf_fpointer’:
SCF.xs:80:20: warning: cast from pointer to integer of different size [-Wpointer-to-int-cast]
ret_val = newSViv((int)scf_data);
^
/usr/lib/x86_64-linux-gnu/perl/5.22/CORE/embed.h:402:40: note: in definition of macro ‘newSViv’
#define newSViv(a) Perl_newSViv(aTHX_ a)
^
SCF.xs: In function ‘XS_Bio__SCF_scf_free’:
SCF.xs:89:17: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
scf_deallocate((Scf *)scf_pointer);
^
SCF.xs: In function ‘XS_Bio__SCF_get_comments’:
SCF.xs:95:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
Scf *scf_data = (Scf *)scf_pointer;
^
SCF.xs: In function ‘XS_Bio__SCF_set_comments’:
SCF.xs:108:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
Scf *scf_data = (Scf *)scf_pointer;
^
SCF.xs: In function ‘XS_Bio__SCF_scf_write’:
SCF.xs:121:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
Scf *scf_data = (Scf *)scf_pointer;
^
SCF.xs: In function ‘XS_Bio__SCF_scf_fwrite’:
SCF.xs:137:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
Scf *scf_data = (Scf *)scf_pointer;
^
SCF.xs: In function ‘XS_Bio__SCF_get_from_header’:
SCF.xs:159:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
Scf *scf_data = (Scf *)scf_pointer;
^
SCF.xs: In function ‘XS_Bio__SCF_get_at’:
SCF.xs:186:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
Scf *scf_data = (Scf *)scf_pointer;
^
SCF.xs: In function ‘XS_Bio__SCF_set_base_at’:
SCF.xs:242:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
Scf *scf_data = (Scf *)scf_pointer;
^
SCF.xs: In function ‘XS_Bio__SCF_set_at’:
SCF.xs:255:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
Scf *scf_data = (Scf *)scf_pointer;
^
rm -f blib/arch/auto/Bio/SCF/SCF.so
x86_64-linux-gnu-gcc -shared -L/usr/local/lib -fstack-protector-strong SCF.o -o blib/arch/auto/Bio/SCF/SCF.so \
-lread -lz \

/usr/local/lib/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
chmod 755 blib/arch/auto/Bio/SCF/SCF.so
"/usr/bin/perl" -MExtUtils::Command::MM -e 'cp_nonempty' -- SCF.bs blib/arch/auto/Bio/SCF/SCF.bs 644
Manifying 1 pod document

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Converting FASTQ to FASTA

Neel — Fri, 12 Jan 2018 03:49:09 -0600

There are several ways you can convert fastq to fasta sequences. Some methods are listed below.

Using SED

sed can be used to selectively print the desired lines from a file, so if you print the first and 2rd line of every 4 lines, you get the sequence header and sequence needed for fasta format.

sed -n '1~4s/^@/>/p;2~4p' INFILE.fastq > OUTFILE.fasta

Using PASTE

You can linerize every 4 lines in a tabular format and print first and second field using paste

cat INFILE.fastq | paste - - - - |cut -f 1, 2| sed 's/@/>/'g | tr -s "/t" "/n" > OUTFILE.fasta

EMBOSS:seqret

Standard script that can be used for many purposes. One such use is fastq-fasta conversion

seqret -sequence reads.fastq -outseq reads.fasta

awk can be used for conversion as follows:

Using AWK

cat infile.fq | awk '{if(NR%4==1) {printf(">%s\n",substr($0,2));} else if(NR%4==2) print;}' > file.fa

FASTX-toolkit

fastq_to_fasta is available in the FASTX-toolkit that scales really well with the huge datasets

fastq_to_fasta -h
usage: fastq_to_fasta [-h] [-r] [-n] [-v] [-z] [-i INFILE] [-o OUTFILE]
# Remember to use -Q33 for illumina reads!
version 0.0.6
       [-h]         = This helpful help screen.
       [-r]         = Rename sequence identifiers to numbers.
       [-n]         = keep sequences with unknown (N) nucleotides.
                   Default is to discard such sequences.
       [-v]         = Verbose - report number of sequences.
                   If [-o] is specified,  report will be printed to STDOUT.
                   If [-o] is not specified (and output goes to STDOUT),
                   report will be printed to STDERR.
       [-z]         = Compress output with GZIP.
       [-i INFILE]  = FASTA/Q input file. default is STDIN.
       [-o OUTFILE] = FASTA output file. default is STDOUT.

Bioawk

Another option to convert fastq to fasta format using bioawk

bioawk -c fastx '{print ">"$name"\n"$seq}' input.fastq > output.fasta

Seqtk

From the same developer, there is another option using a tool called seqtk

seqtk seq -a input.fastq > output.fasta

Note that you can use either compressed or uncompressed files for this tool