<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/43042?offset=20</link>
	<atom:link href="https://bioinformaticsonline.com/related/43042?offset=20" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/21096/how-to-prepare-your-bioinformatics-cv</guid>
	<pubDate>Mon, 09 Feb 2015 01:50:01 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/21096/how-to-prepare-your-bioinformatics-cv</link>
	<title><![CDATA[How to Prepare your Bioinformatics CV ?]]></title>
	<description><![CDATA[<p>Preparing a CV is also an art as well as a requirement for a person applying for a job .<br /> Curriculum Vitae is the first impression on the employer so it should be the best.How It can be the best can be learnt.Here is a link where you can get guidelines on how CV can be prepared and a sample also. Preparing your own Curriculum Vitae can seem a daunting task, quite apart from what to put in and what to leave out, describing your own strengths and abilities isn't easy. What we have tried to do with the following guidelines is to make the whole process a much easier one and ensure that you end up with a professional document which shows you how to pitch your skills and stand out from the crowd. In the current economic and employment climate, employers are looking to consistently improve on productivity and match a prospective employee's skills and experience with the job needs, both now and in the future.<br /> <strong><br /> Presentation and layout</strong><br /> Always ensure that your CV is laser-printed on white, good quality paper, use a clean typeface and don't go smaller than 12 point.<br /> The use of sub-headings (e.g. Personal details, career history, etc.) will help potential employers glean the information they require with ease.<br /> There should be clear spaces between category headings for easy clarification and definition.<br /> Your name, address and phone number(s) should form the start of the document. If you are giving a work number add the following - 'please use with discretion.'<br /> Commencing with your present or most recent employer, state your career history. Then list your professional qualifications. If you have been working for many years list your academic qualifications and a very brief mention as to your college or schooling.<br /> If you are just commencing your working life, having previously been a student, provide more in depth knowledge regarding your academic achievements to date.<br /> <br /> <strong>Content</strong></p><p>Starting with your current or most recent employment provide details of your position as follows:</p><ul>
<li>A chronological CV should be arranged in reverse chronological order. It should be apparent immediately where you are now.</li>
<li>Remember that an application form is limited to the few things that a particular institution wants to know about everybody. A CV lets you give information that is unique to you. Add all your key accomplishments and activities in the initial draft. In subsequent drafts, you can remove information that may not be pertinent.</li>
<li>Resist the temptation to append explanatory sentences or language, which will distract the reader from the basic information being presented. The language of a CV is abbreviated and succinct. When applying for residency training, you will have the opportunity to express yourself in a personal or biographical statement. In the future, when applying for a job or some other type of position, you will want to include an appropriate cover letter with your CV to explain your particular qualifications and strengths for the position.</li>
<li>Don&rsquo;t despair if your CV doesn&rsquo;t resemble those of other students who are applying to the same residency program. Everybody&rsquo;s CV is different. Even if everyone used the same format suggested in this section, your CV will not resemble others&rsquo; because it doesn&rsquo;t have the same content. No residency program director is looking for a specific CV style. You will receive points for neatness, and readability.</li>
<li>Be honest. If you haven&rsquo;t accomplished anything in a particular category, leave it out. Don&rsquo;t create accomplishments to fill in the spaces. You can be specific about your level of participation in a project or activity, but don&rsquo;t be misleading (i.e., you can say you coordinated membership recruitment for your AMSA chapter, but don&rsquo;t say you were &ldquo;president&rdquo; unless you were).</li>
</ul><ul>
<li>Job title - time that you have held this position</li>
<li>The key tasks and responsibilities that comprise this role's requirements - notable achievements whilst in the role</li>
<li>Where possible quantify your achievements with precise facts and figures, e.g. managed junior staff, handled department budget, prepared management reports</li>
<li>Expand on the skills you are using in your current job which you believe will be valuable in the position(s) for which you are applying</li>
</ul><p>It is not necessary to state the reason you are leaving your current position. This will be a topic for conversation when you are invited for interview or can be covered in your letter of application.<br /> For all previous employment, unless one appointment was more significant than your current or last position, keep details brief i.e. the name of the company, job title, period of employment and the job.<br /> Be sure there are no gaps in your career history - unless for example you took a year out to travel, in which case make reference to this under Interests/Hobbies.<br /> If you are a student just starting work, give any evidence you can to demonstrate your practical skills e.g. school prefect, event organisation, member of sports team, contributor to college magazine or voluntary work.<br /><br /> You are under no obligation to disclose marital status, age or whether or not you have children unless these are specific criteria for selection for a position that you are interested in.<br /> Consider what examples (interests/ hobbies) you can give to show that you match the selection criteria.<br /><br /> If they want someone to work as part of a large team, remember to say if you belong to a local organisation or if you are part of a sports team.<br /><br /> If they want someone who will work on their own for large periods of time, make reference to an Open University course you are considering undertaking.<br /><br /> Your primary objective is to convince the prospective employer that you have the requisite skills, experience and hunger to do the job.<br /><br /> Your CV should be no more than two A4 pages and as every employer is different remember to customise your CV to every job you go after.</p><p>There are abundant books on the contents and presentation of a general CV. A BMJ article published in 1978, offering doctors guidance on how to prepare a CV, has been reprinted in the widely read How to do it series.1 2 A survey among postgraduate deans and training advisers at regional colleges found that the contents and presentation of a model CV for doctors in training has been published.3 It is perhaps surprising to note that these models differ significantly from one another. Although they may be useful as starting points, their differences tend to create confusion and anxiety among students. I would argue that these differences exist because the content and presentation of the "ideal" CV vary considerably among individual applicants, the stage of their careers, and the purposes for which the CV is used. It is impossible to create a generic CV. I have therefore not attempted to draw up another model CV. Rather, the purpose of this article is to outline the general principles and important practical points in preparing a good CV. General principles on contents Before finalising your CV for a particular purpose you must be sure of your objectives, whether it is used as an initial screening or the only selection instrument, and the criteria against which it is judged. What details, and how many of them, to include in your CV depends on these factors. I shall illustrate with examples relevant to medical students.&nbsp;<br /> <br /> (1) Job application Your objective is to get the job. In a job application, the CV is used for two purposes: as an initial screening instrument for shortlisting candidates and as a framework for discussion during the interview. The explicit criteria used for shortlisting are usually given in the job advertisement. For some organisations, separate lists of essential and desirable criteria are given. Alternatively, you can get a good idea of the basic requirements from the job description. Your CV must clearly highlight these criteria, preferably on the first page. These usually include: formal qualifications; registration with the General Medical Council; and the prescribed experience. It is sometimes easy to forget to mention items specifically asked for in the job description (for example, a valid driving licence). The implicit criteria are less easy to pinpoint. For example, how much detail on your BSc dissertation and publications should you include? Should you make a long list of extracurricular activities, interests outside medicine, and positions of responsibility? If you admit to a wide range of extracurricular activities and interests, would you be considered as a candidate with a well balanced mature personality or will it be interpreted to mean that you will have little time or interest to do your job? There are no easy answers. Common sense might tell you that BSc dissertation and publications are more important in application for teaching hospital or research posts, but less important for district hospital posts. Conversely, you might think that interests outside medicine are more important for posts in district hospitals or in general practice. This is, however, not always true. A few consultants at district hospital are highly academic. Information gathered from students and doctors working under the professor or consultant concerned may be vital. Alternatively, it is worth while doing your homework by looking up your prospective consultant in the medical directory. This may occasionally prompt you to include information that you might otherwise have left out. For example, you may find that the consultant qualified in Scotland and has previously worked in Scotland for a considerable time, and you may decide to add in your CV that you studied in a Scottish secondary school. Since the CV is only used as for initial screening, you need not go into your previous experience or extracurricular activities in too much detail. Highlight only the most significant points, and leave the details for the interview. If you are applying for a clinical post, one of your referees should be a consultant for whom you have worked as a student. You should ask for permission to use his/her name before submitting your application.&nbsp;<br /> <br /> (2) Application for research scholarship or PhD studentship The CV and application form are sometimes used as the sole selection instrument, and you must make enquiries before you submit your application. Clearly, academic ability is the main criterion for selection, and you should include as much information relevant to your academic ability and interests as you can. Examples are your A levels, your BSc dissertation, any publications (even in the form of a letter in newspaper), any experience as an editor (for example, for your school magazine). Your extracurricular activities are less important, and you can simply give a short list. At least one of the referees should be an academic - for example, your previous supervisor in your BSc degree.<br /> &nbsp;<br /> (3) Application to join a clinical course in another medical school Preclinical students who have completed an intercalated degree often have the option of applying to join a clinical course in another medical school, although it may become more difficult to do so with the introduction of the new GMC curriculum. Your CV is usually used for shortlisting candidates for interview. The criteria differ slightly among medical schools, but both academic ability and contribution to university life are important. Hence, not only should you highlight your academic achievements but you must also highlight your participation in the university (for example, in sports or music).&nbsp;<br /> <br /> (4) For the information of your tutor or counsellor For most medical schools, you are allocated a tutor who provides both academic and non-academic support and monitors your progress throughout your study on a confidential basis. Students are sometimes asked to submit their up to date CV to their tutors for information. Assuming that the tutors are helpful there is little to gain from over emphasising your strengths or hiding your weaknesses. Once you become a doctor in training after you qualify you will need to undergo an annual assessment of your progress. It serves to certify that you have reached a satisfactory standard, but it is also used as an aid to identify and help with your weaknesses. You may find it difficult to balance these two purposes in presenting your CV. General principles on presentation Now that all students are computer literate, there should be few problems in preparing a well presented CV. The following list serves as a reminder on how to present your CV effectively: Spelling or grammar mistakes - do not rely purely on the spell check on your computer. Ask friends to proofread your CV for you. Consistency - The use of punctuation to open and close sentences, justification, and fonts should be consistent. Readability - The headings should be clear. The font size should be no less than 12 point. Basic criteria - The basic criteria should be easily located, preferably on the first page. Length - The length of your CV increases as you progress up the professional ladder. For students, it should generally be no more than three pages. Quality of print - The CV should be printed on good quality paper, preferably using a laser printer. Practical points In this article, I argue that different versions of a CV may be required for different purposes. Even applications for different posts in the same specialty may require slightly different versions. Also, CVs need to be updated regularly. This would have been time consuming to achieve in the past, but it is now quite simple, with the aid of a basic word processing package. A master CV containing all relevant information should be prepared and saved as a computer file. This should be continuously kept up to date. When the need for a CV arises, it can be tailormade by editing the master document. It is important to save each of these edited versions separately, with the file names indicating the date when it was created and the purpose. It is also important to prepare a cover letter to go with the CV. Key messages A good CV is essential for successful progression up the medical professional ladder The contents of the CV should be tailormade for the purpose it is used for and the criteria against which it is judged. It is important to gather information about these criteria first The CV must be technically well presented, with the basic criteria easily located Information technology has made it simple to regularly update our CVs and allows preparation of different versions of a CV for different purposes with relative ease.</p><p><strong>Reference:</strong></p><p>Prepare a curriculum vitae. BMJ 1978;25(2):1478-9.<br /> O'Brien E. Prepare a curriculum vitae. In: Reece D, ed.&nbsp;<br /> How to do it. Vol 1. London: BMJ Publishing Group, 1995 Chambler AF, Chapman-Sheath PJ, Pearse MF.&nbsp;<br /> A model curriculum vitae: what are the trainers looking for? Hosp Med 1998;59(4):324-6.</p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/22073/bcil-bioinformatics-bitp-application</guid>
	<pubDate>Fri, 17 Apr 2015 04:34:56 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/22073/bcil-bioinformatics-bitp-application</link>
	<title><![CDATA[BCIL Bioinformatics BITP Application !!]]></title>
	<description><![CDATA[<p>BCIL Bioinformatics BITP Application Form 2015 logoGrab latest Information! Biotech Consortium India Limited has announced a notification for offering admission in Biotech Industrial Training Program. The organization has invited online application from 7th April 2015 BCIL Admission 2015. BCIL has conducted an entrance exam which is scheduled on 20th June 2015. Candidates those who are looking for this program just go for it and don&rsquo;t miss this opportunity.<br /><br />To apply for Biotech Industrial Training Programme the candidates should have 50% marks in B.Tech/BE/M.Tech Degree in Bio technology, bio process technology and other related disciplines form any recognized institution. The organization has decided application fee of Rs.500/- for all candidates and that should be paid through demand draft. Applicants who satisfy the organization requirement, they can take their steps forward.<br /><br />Candidates should submit the online application before 10th May 2015. After registering the online application you need to take the hard copy of it and send through post. Print out of this application should be reached before 15th May 2015. All the latest updates like selection process, exam syllabus and other related information are updated soon at the main URL of the department and aspirants should keep in touch with this site. Further details of BCIL Bioinformatics BITP Application Form 2015 are explained below.<br /><br />Organization: Biotech Consortium India Limited<br /><br />Website URL: www.bcil.nic.in<br /><br />Location: New Delhi<br /><br />Course Name: Biotech Industrial Training Program<br /><br />Exam Name: BCIL Entrance Exam<br /><br />Educational Details: Applicants should complete their B.Tech/M.Tech/BE programs in Neuro- Science, Agricultural, Bio technology, bio process technology and other related disciplines having 50% aggregate from any authorized university.<br /><br />Application Fee: For all candidates application fee is Rs.500/- and it will be paid through Demand Draft drawn in favour of BCIL, New Delhi.<br /><br />How to Apply: Candidates who are willing to apply for this program they can apply through online mode. Then send the hard copy of registered application form to through post.<br /><br />Important Dates<br /><br />Opening Date of Submission Online Application Form: 7h April 2015<br /><br />Closing Date of Submission of Online Application Form: 10th May 2015<br /><br />Last Date of Receipt of Application Form: 15th May 2015<br /><br />Exam Date: 20th June 2015</p><p>More at http://bcil.nic.in/default.htm</p>]]></description>
	<dc:creator>Pranjali Yadav</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/22044/binc-sample-question-paper</guid>
	<pubDate>Thu, 16 Apr 2015 09:12:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/22044/binc-sample-question-paper</link>
	<title><![CDATA[BINC Sample Question Paper !!!]]></title>
	<description><![CDATA[<p>BINC sample question paper for round ONE.</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/22044" length="1260" type="text/plain" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/22068/binc-examination-2015</guid>
	<pubDate>Fri, 17 Apr 2015 03:34:28 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/22068/binc-examination-2015</link>
	<title><![CDATA[BINC examination 2015 !!!]]></title>
	<description><![CDATA[<p>BioInformatics National Certification (BINC) Examination 2015 organized by Department of Biotechnology, Government of India, New Delhi Pondicherry University, Puducherry</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/22068" length="281577" type="application/pdf" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</guid>
	<pubDate>Tue, 23 Jun 2015 10:39:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</link>
	<title><![CDATA[At what age did you gain passion in Bioinformatics?]]></title>
	<description><![CDATA[<p>Most of the bioinformatician were biologist ( yeah ... not all ;), and at later stage they gain a passion in Bioinformatics and learn it. When did you get inclined towards computational analysis of biological data?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/23892/bioinformatics-made-easy-search-bioinformatics-tools-and-run-genomic-analysis-in-the-cloud</guid>
	<pubDate>Thu, 20 Aug 2015 02:21:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/23892/bioinformatics-made-easy-search-bioinformatics-tools-and-run-genomic-analysis-in-the-cloud</link>
	<title><![CDATA[Bioinformatics Made Easy Search: Bioinformatics tools and run genomic analysis in the cloud]]></title>
	<description><![CDATA[<p>InsideDNA makes hundreds of bioinformatics tools immediately available to run via an easy-to-use web interface and allows an accurate search across all functions, tools and pipelines.</p>
<p>With InsideDNA, you can upload and store your own genomic/genetic datasets in a limitless cloud space, and instantly analyze it with a powerful compute instance, without any tool installation or set up hassle.</p>
<p>More at https://insidedna.me/</p><p>Address of the bookmark: <a href="https://insidedna.me/" rel="nofollow">https://insidedna.me/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26539/scikit-learn</guid>
	<pubDate>Mon, 29 Feb 2016 17:39:24 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26539/scikit-learn</link>
	<title><![CDATA[scikit-learn]]></title>
	<description><![CDATA[<p>Machine Learning in Python</p>
<p>Simple and efficient tools for data mining and data analysis<br> Accessible to everybody, and reusable in various contexts<br> Built on NumPy, SciPy, and matplotlib<br> Open source, commercially usable - BSD license</p>
<p>More at&nbsp;http://scikit-learn.org/stable/index.html</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://scikit-learn.org/stable/auto_examples/index.html" rel="nofollow">http://scikit-learn.org/stable/auto_examples/index.html</a></p>]]></description>
	<dc:creator>Jitendra Prajapati</dc:creator>
</item>

</channel>
</rss>