<![CDATA[BOL: Related items]]> https://bioinformaticsonline.com/related/43042?offset=30 https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl Tue, 09 Jun 2015 23:38:44 -0500 https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl <![CDATA[Frequent words problem solution by Perl]]>

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

]]> Jit https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl Wed, 10 Jun 2015 00:17:17 -0500 https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl <![CDATA[Clump Finding Problem Solved with Perl]]> The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

]]> Jit https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics Tue, 23 Jun 2015 10:39:06 -0500 https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics <![CDATA[At what age did you gain passion in Bioinformatics?]]> Most of the bioinformatician were biologist ( yeah ... not all ;), and at later stage they gain a passion in Bioinformatics and learn it. When did you get inclined towards computational analysis of biological data?

]]> Jit https://bioinformaticsonline.com/bookmarks/view/23892/bioinformatics-made-easy-search-bioinformatics-tools-and-run-genomic-analysis-in-the-cloud Thu, 20 Aug 2015 02:21:20 -0500 https://bioinformaticsonline.com/bookmarks/view/23892/bioinformatics-made-easy-search-bioinformatics-tools-and-run-genomic-analysis-in-the-cloud <![CDATA[Bioinformatics Made Easy Search: Bioinformatics tools and run genomic analysis in the cloud]]> InsideDNA makes hundreds of bioinformatics tools immediately available to run via an easy-to-use web interface and allows an accurate search across all functions, tools and pipelines.

With InsideDNA, you can upload and store your own genomic/genetic datasets in a limitless cloud space, and instantly analyze it with a powerful compute instance, without any tool installation or set up hassle.

More at https://insidedna.me/

Address of the bookmark: https://insidedna.me/

]]> Rahul Nayak https://bioinformaticsonline.com/bookmarks/view/26539/scikit-learn Mon, 29 Feb 2016 17:39:24 -0600 https://bioinformaticsonline.com/bookmarks/view/26539/scikit-learn <![CDATA[scikit-learn]]> Machine Learning in Python

Simple and efficient tools for data mining and data analysis
Accessible to everybody, and reusable in various contexts
Built on NumPy, SciPy, and matplotlib
Open source, commercially usable - BSD license

More at http://scikit-learn.org/stable/index.html

 

Address of the bookmark: http://scikit-learn.org/stable/auto_examples/index.html

]]> Jitendra Prajapati https://bioinformaticsonline.com/bookmarks/view/32076/ngs-teaching-material Wed, 05 Apr 2017 04:29:06 -0500 https://bioinformaticsonline.com/bookmarks/view/32076/ngs-teaching-material <![CDATA[NGS teaching material]]> High throughput sequencing (HTS) technologies are being applied to a wide range of important topics in biology. However, the analyses of non-model organisms, for which little previous sequence information is available, pose specific problems. This course addresses the specific strengths and weaknesses of alternative HTS technologies, the computational resources needed for HTS, and how to analyze non-model species using HTS. The course consists of a practical training module, HTS bioinformatics training, and lecturing/seminars of HTS approaches specifically targeting non-model organisms.

Address of the bookmark: http://marinetics.org/teaching/hts/Assembly.html

]]> Jit https://bioinformaticsonline.com/pages/view/42813/bioinformatics-in-africa-part5-nigeria Sat, 06 Feb 2021 21:13:47 -0600 https://bioinformaticsonline.com/pages/view/42813/bioinformatics-in-africa-part5-nigeria <![CDATA[Bioinformatics in Africa: Part5 - Nigeria]]> Covenant University (CU)­Ota:
Covenant University (with her enriching and growing state­of­the­art laboratories in the area of  science and technology, arts, business and social sciences) is presently the Best University in  Nigeria (Private University category), based on the recent over­all rating just concluded by the  Nigeria   University   Commission   (NUC).   Recently,   Covenant   University   has   initiated   the  establishment of a Centre for Applied Biotech, Bio­Informatics and Microbiology (CBBM) to be  situated at the University. The institute has been designed to be a Public­Private Partnership for a productive synergy b/w Academia, Industry and Government. The whole concept is still evolving  and more details will be release soon. As regards CBBM, a dedicated computing lab is in plan, but even our computing capacity is  presently enormous. In the department of Computer and Information Sciences, we have more than  250 Pentium 4 PCs set aside for teaching and research purposes. Furthermore, we have several  moderate speed PCs at the Postgraduate research lab and our engineering departments and units.  Our wet lab facilities is presently minimal (basic for teaching), the Centre requirement as it touches  the wet­laboratories is also set to upgrade this to basic tools expected at an international centre of learning.

University of Ibadan (UIB)­Ibadan:
There has been significant increase in the number of bioinformatics activities in Nigeria (and West Africa) since 2003 when the program was initiated by the West African Biotechnology Workshops Series (WABWS, http://www.wabw.org) at the University of Ibadan, Nigeria (in collaboration with  the South African National Bioinformatics Institute (SANBI, http:/www.sanbi.ac.za). Workshops  that were open to scientists from all African countries have seen a very high number of applications  from scientists based in West Africa. The encouraging desire to acquire cutting­edge skills to  computational process data and extract useful knowledge from genome projects led to the interest of  the West African Biotechnology Workshops (WABW) to develop an agenda to address the  bioinformatics skills gap among scientists in West Africa. An increased commitment from agencies  like NEPAD would be required in the provision of infrastructure to establish and sustain regional  and national networks.

University of Ilorin (UIL)­Ilorin:
The University of Ilorin was established in 1976 by the Federal Government of Nigeria.  Bioinformatics activities started at the University in February 2003 with the establishment of the  West African Bioinformatics Research Initiative (WABRI). However, progress has been rather slow  due to inadequate funding. We are mainly engaged in Bioinformatics training at the introductory  level and proteomics studies on various species of malaria parasites. Recently, we became interested  in comparative genome analysis of various species of  Plasmodium  and the comparison of  chloroquine sensitive and chloroquine resistant strains of Plasmodium falciparum. Other activities  and areas of interest can be seen on our website, http://www.wabri.org, although not all our  proposed interests have been fully implemented due to our level of funding.

Training:
The University of Ilorin has introduced M.Sc. and Ph.D. programmes in Computer Science (with  options in Bioinformatics). The programme is based in the Department of Computer Science and  emphasis is on the development of algorithms to solve problems in bioinformatics. The Covenant University offers M.Sc. and Ph.D in Computer Science with option in Bioinformatics  (Computational Biology). Furthermore, through affiliated departments, the CBBM is been design to award Diploma and Degree certificates in Biotechnology.

Web sites and links: http://www.covenantuniversity.com http://www.run.edu.ng http://www.uniben.edu http://www.wabri.org http://www.wabw.org http://www.unilorin.edu.ng http://www.wabri.org http://www.asopah.org

]]> BioStar https://bioinformaticsonline.com/pages/view/35805/python-learning-resources-for-bioinformatics-and-computational-biologist Fri, 02 Mar 2018 06:54:15 -0600 https://bioinformaticsonline.com/pages/view/35805/python-learning-resources-for-bioinformatics-and-computational-biologist <![CDATA[Python learning resources for bioinformatics and computational biologist !]]> Python is a general-purpose language, which means it can be used to build just about anything, which will be made easy with the right tools/libraries.

Professionally, Python is great for backend web development, data analysis, artificial intelligence, and scientific computing. Many developers have also used Python to build productivity tools, games, and desktop apps, so there are plenty of resources to help you learn how to do those as well.

For pros and cons visit http://www.bestprogramminglanguagefor.me/why-learn-python and http://bioinformaticsonline.com/discussion/view/459/python-vs-perl

More resources at https://github.com/CodementorIO/Python-Learning-Resources

Following are the list of useful python programming resources:

]]> Jit https://bioinformaticsonline.com/pages/view/36603/learning-python-programming-a-bioinformatician-perspective Mon, 14 May 2018 16:33:03 -0500 https://bioinformaticsonline.com/pages/view/36603/learning-python-programming-a-bioinformatician-perspective <![CDATA[Learning Python Programming - a bioinformatician perspective !]]> Python Programming is a general purpose programming language that is open source, flexible, powerful and easy to use. One of the most important features of python is its rich set of utilities and libraries for data processing and analytics tasks. In the current era of big biological data, python and biopython is getting more popularity due to its easy-to-use features which supports big data processing.

In this tutorial series article, I will explore features and packages of python which are widely used in the big data, NGS, and bioinformatics. I will also walk through a real biological example which shows NGS data processing with the help of python packages and programming.

Python has a couple of points to recommend it to biologists and scientists specifically:

  • It's widely used in the scientific community
  • It has a couple of very well designed libraries for doing complex scientific computing (although we won't encounter them in this book)
  • It lend itself well to being integrated with other, existing tools
  • It has features which make it easy to manipulate strings of characters (for example, strings of DNA bases and protein amino acid residues, which we as biologists are particularly fond of)

In general, following are some of the important features of python which makes it a perfect fit for rapid application development.

  • Python is interpreted language so the program does not need to be compiled. Interpreter parses the program code and generates the output.
  • Python is dynamically typed, so the variables types are defined automatically.
  • Python is strongly typed. So the developers need to cast the type manually.
  • Less code and more use makes it more acceptable.
  • Python is portable, extendable and scalable.

There are two major Python versions, Python 2 and Python 3. Python 2 and 3 are quite different. This tutorial uses Python 3, because it more semantically correct and supports newer features.

I will post tutorial on daily basis on this page. Check the sub-pages on right side.

]]> Rahul Nayak https://bioinformaticsonline.com/news/view/39606/amity-university-bioinformatics-summer-program-kolkata Tue, 11 Jun 2019 21:27:10 -0500 https://bioinformaticsonline.com/news/view/39606/amity-university-bioinformatics-summer-program-kolkata <![CDATA[Amity University Bioinformatics Summer Program - Kolkata]]> Registrations are now open for the 2019 Summer Bioinformatics Training program at Amity University, Kolkata. The program will focus on introductory topics for life science students. We will review important history, topics and challenges bioinformatics can help address in the context of basic research, discovery and industry.

Read more: https://edu.t-bio.info/amity-university-summer-bioinformatics-program-registrations-are-open/

]]> eliabrodsky