<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/43057?offset=460</link>
	<atom:link href="https://bioinformaticsonline.com/related/43057?offset=460" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</guid>
	<pubDate>Tue, 08 May 2018 04:52:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</link>
	<title><![CDATA[Metassembler: merging and optimizing de novo genome assemblies]]></title>
	<description><![CDATA[<p><span>Metassembler combines multiple whole genome de novo assemblies into a combined consensus assembly using the best segments of the individual assemblies.</span></p>
<p><span><span>Genome assembly projects typically run multiple algorithms in an attempt to find the single best assembly, although those assemblies often have complementary, if untapped, strengths and weaknesses. We present our metassembler algorithm that merges multiple assemblies of a genome into a single superior sequence.&nbsp;</span></span></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/metassembler/?source=directory" rel="nofollow">https://sourceforge.net/projects/metassembler/?source=directory</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</guid>
	<pubDate>Thu, 26 Jul 2018 04:58:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</link>
	<title><![CDATA[My commonly used commands in Bioinformatics]]></title>
	<description><![CDATA[<p>FYI, I've found it useful to use MUMmer to extract the specific changes that Racon makes, so I can evaluate them individually:</p><pre><code>minimap -t 24 assembly.fasta long_reads.fastq.gz | racon -t 24 long_reads.fastq.gz - assembly.fasta racon_assembly.fasta
nucmer -p nucmer assembly.fasta racon_assembly.fasta
show-snps -C -T -r nucmer.delta
</code></pre><p>This reports Racon's changes in a table. You can exclude indels with the&nbsp;<code>-I</code>&nbsp;option in&nbsp;<code>show-snps</code>.&nbsp;</p><p>This process (Racon -&gt; MUMmer -&gt; SNP table) solves the problem I originally raised in this issue. So as far as I'm concerned, you can close this issue (or keep it open if you still want to implement some kind of variant table).</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</guid>
	<pubDate>Thu, 25 Oct 2018 09:38:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</link>
	<title><![CDATA[Scribl : HTML5 canvas genomics graphic library]]></title>
	<description><![CDATA[<p>Scribl is a javascript, Canvas-based graphics library that easily generates biological visuals of genomic regions, alignments, and assembly data. Scribl can also be used in conventional offline pipelines, since everything needed to generate charts can be contained in a single html file.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://chmille4.github.io/Scribl/" rel="nofollow">http://chmille4.github.io/Scribl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38166/pygenometracks-standalone-program-and-library-to-plot-beautiful-genome-browser-tracks</guid>
	<pubDate>Fri, 09 Nov 2018 12:34:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38166/pygenometracks-standalone-program-and-library-to-plot-beautiful-genome-browser-tracks</link>
	<title><![CDATA[pyGenomeTracks: Standalone program and library to plot beautiful genome browser tracks]]></title>
	<description><![CDATA[<p>pyGenomeTracks aims to produce high-quality genome browser tracks that are highly customizable. Currently, it is possible to plot:</p>
<ul>
<li>bigwig</li>
<li>bed (many options)</li>
<li>bedgraph</li>
<li>links (represented as arcs)</li>
<li>Hi-C matrices (if&nbsp;<a href="http://hicexplorer.readthedocs.io/">HiCExplorer</a>&nbsp;is installed)</li>
</ul><p>Address of the bookmark: <a href="https://github.com/deeptools/pyGenomeTracks" rel="nofollow">https://github.com/deeptools/pyGenomeTracks</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41831/merqury-reference-free-quality-and-phasing-assessment-for-genome-assemblies</guid>
	<pubDate>Sat, 06 Jun 2020 05:38:34 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41831/merqury-reference-free-quality-and-phasing-assessment-for-genome-assemblies</link>
	<title><![CDATA[Merqury: reference-free quality and phasing assessment for genome assemblies]]></title>
	<description><![CDATA[<p><span>Often, genome assembly projects have illumina whole genome sequencing reads available for the assembled individual. The k-mer spectrum of this read set can be used for independently evaluating assembly quality without the need of a high quality reference. Merqury provides a set of tools for this purpose.</span></p>
<p><span><a href="https://github.com/marbl/meryl">https://github.com/marbl/meryl</a></span></p><p>Address of the bookmark: <a href="https://github.com/marbl/merqury" rel="nofollow">https://github.com/marbl/merqury</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38579/genomeview-genome-browser-and-annotation-editor</guid>
	<pubDate>Wed, 02 Jan 2019 04:09:06 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38579/genomeview-genome-browser-and-annotation-editor</link>
	<title><![CDATA[GenomeView: genome browser and annotation editor]]></title>
	<description><![CDATA[<p><span>GenomeView is a genome browser and annotation editor that displays reference sequence, annotation, multiple alignments, short read alignments and graphs. Most major data formats are supported. Local and internet files can be loaded.</span><br><span>This project has moved to GitHub:&nbsp;</span><a href="https://github.com/GenomeView/genomeview" target="_blank">https://github.com/GenomeView/genomeview</a></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/genomeview/" rel="nofollow">https://sourceforge.net/projects/genomeview/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/39704/the-rogers-lab</guid>
  <pubDate>Mon, 15 Jul 2019 08:07:44 -0500</pubDate>
  <link></link>
  <title><![CDATA[The Rogers Lab]]></title>
  <description><![CDATA[
<p>The Rogers lab studies evolution of genome structure. We explore the ways that complex mutations like duplications, deletions, rearrangements, and retrogenes can create new genetic material. We study how these new mutations are important for adaptation. We are currently working on projects in Drosophila, Mammoths, Elephants, Bivalves, and Frogs absolutely no amphibians. This multi-organism approach can help us understand when and why complex mutations are important for organism fitness.</p>

<p>More at http://evolscientist.com/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40140/alf-a-simulation-framework-for-genome-evolution</guid>
	<pubDate>Tue, 22 Oct 2019 22:05:58 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40140/alf-a-simulation-framework-for-genome-evolution</link>
	<title><![CDATA[ALF--a simulation framework for genome evolution.]]></title>
	<description><![CDATA[<p style="color: #000000; font-size: small; font-style: normal; font-weight: 400; text-align: -webkit-left;"><span style="color: #4d4d4d; font-size: small; font-style: normal; font-weight: 400; text-align: left; background-color: #ffffff; float: none;">Artificial Life Framework (ALF)</span> simulates a root genome into a number of related genomes. Result files include the resulting gene sequences, true tree and true MSAs. A description of ALF can be found in the following article:</p>
<p style="color: #000000; font-size: small; font-style: normal; font-weight: 400; text-align: -webkit-left;">Daniel A Dalquen, Maria Anisimova, Gaston H Gonnet, Christophe Dessimoz: ALF - A Simulation Framework for Genome Evolution.<span>&nbsp;</span><em>Mol Biol Evol</em>, 29(4):1115-1123, April 2012.<br><a href="http://mbe.oxfordjournals.org/content/29/4/1115" target="_blank">http://mbe.oxfordjournals.org/content/29/4/1115</a></p><p>Address of the bookmark: <a href="http://alfsim.org/#index" rel="nofollow">http://alfsim.org/#index</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>