<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/43088?offset=480</link>
	<atom:link href="https://bioinformaticsonline.com/related/43088?offset=480" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44537/the-atcc-genome-portal</guid>
	<pubDate>Wed, 15 May 2024 14:24:16 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44537/the-atcc-genome-portal</link>
	<title><![CDATA[The ATCC Genome Portal]]></title>
	<description><![CDATA[<p><span>The ATCC Genome Portal (AGP,&nbsp;</span><a href="https://genomes.atcc.org/">https://genomes.atcc.org/</a><span>) is a database of authenticated genomes for bacteria, fungi, protists, and viruses held in ATCC&rsquo;s biorepository. It now includes 3,938 assemblies (253% increase) produced under ISO 9000 by ATCC. Here, we present new features and content added to the AGP for the research community.</span></p><p>Address of the bookmark: <a href="https://genomes.atcc.org/" rel="nofollow">https://genomes.atcc.org/</a></p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44503/entire-human-genome-sequencing</guid>
	<pubDate>Tue, 02 Apr 2024 01:19:29 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44503/entire-human-genome-sequencing</link>
	<title><![CDATA[Entire Human Genome Sequencing !]]></title>
	<description><![CDATA[<p>Cost-effective whole human genome sequencing has revolutionized the landscape of genetic research and personalized medicine by making comprehensive genetic analysis accessible to a wider population. Through advancements in sequencing technologies, such as next-generation sequencing (NGS), costs have significantly decreased, enabling researchers and healthcare providers to analyze an individual's complete genetic makeup with greater efficiency and affordability. This has profound implications for disease diagnosis, prognosis, and treatment, as it allows for the identification of genetic predispositions and the customization of healthcare interventions based on an individual's unique genetic profile. Moreover, as the cost continues to decline, the potential for population-scale genomic studies and large-scale screening programs becomes increasingly feasible, promising to further enhance our understanding of human genetics and improve healthcare outcomes on a global scale.</p><p>Here are few companies:</p><p>https://mynucleus.com/</p><p>https://myome.com/</p><p>https://nebula.org/whole-genome-sequencing-dna-test/</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44775/genomic-architecture-surrounding-the-fusion-site-of-human-chromosome-2</guid>
	<pubDate>Tue, 04 Mar 2025 12:26:29 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44775/genomic-architecture-surrounding-the-fusion-site-of-human-chromosome-2</link>
	<title><![CDATA[Genomic architecture surrounding the fusion site of human chromosome 2]]></title>
	<description><![CDATA[<p>The article <strong>"Genomic Structure and Evolution of the Ancestral Chromosome Fusion Site in 2q13&ndash;2q14.1 and Paralogous Regions on Other Human Chromosomes (https://pmc.ncbi.nlm.nih.gov/articles/PMC187548/)"</strong> explores the genomic architecture surrounding the fusion site of human chromosome 2. This fusion event is a key evolutionary marker distinguishing humans from other great apes, as humans have 46 chromosomes while chimpanzees, gorillas, and orangutans possess 48. The fusion occurred through an end-to-end joining of two ancestral chromosomes, which remain separate in nonhuman primates.</p><h3><strong>Key Findings:</strong></h3><ol>
<li>
<p><strong>Chromosomal Fusion and Its Molecular Signature:</strong></p>
<ul>
<li>The fusion site is located at <strong>2q13&ndash;2q14.1</strong> and is characterized by <strong>degenerate telomeric sequences</strong> appearing interstitially, indicating the historical head-to-head joining of ancestral chromosomes.</li>
<li>Despite being a signature of a past fusion event, these telomeric repeats are no longer functional and have undergone sequence degradation over time.</li>
</ul>
</li>
<li>
<p><strong>Extensive Duplications in the Surrounding Genomic Region:</strong></p>
<ul>
<li>The study identifies <strong>large-scale segmental duplications</strong> flanking the fusion site, with several of these regions duplicated and scattered across multiple chromosomes.</li>
<li>These duplications are predominantly located in <strong>subtelomeric and pericentromeric regions</strong>, suggesting their role in genomic instability and chromosomal evolution.</li>
</ul>
</li>
<li>
<p><strong>Paralogous Regions and Their Evolutionary Relationships:</strong></p>
<ul>
<li>A <strong>168-kilobase (kb) segment</strong> near the fusion site has <strong>98%&ndash;99% sequence identity</strong> with three regions on <strong>chromosome 9 (9pter, 9p11.2, and 9q13)</strong>.</li>
<li>Another <strong>67-kb region distal to the fusion site</strong> shows a high degree of homology to sequences in <strong>chromosome 22qter</strong>.</li>
<li>Additionally, a <strong>100-kb segment</strong> exhibits <strong>96% sequence identity</strong> with a region in <strong>chromosome 2q11.2</strong>.</li>
</ul>
</li>
<li>
<p><strong>Comparative Genomics and Evolutionary Implications:</strong></p>
<ul>
<li>By comparing the duplicated sequences and their arrangement in primates, the researchers traced the order of duplication events leading to their present distribution.</li>
<li>The presence of specific repetitive elements within these duplicated segments serves as <strong>evolutionary markers</strong> that help infer their historical rearrangements.</li>
<li>Some of these <strong>duplicated regions are associated with chromosomal inversion breakpoints</strong>, potentially contributing to evolutionary changes in primates.</li>
<li>Recurrent <strong>structural rearrangements</strong> in these regions have been linked to human chromosomal disorders.</li>
</ul>
</li>
</ol><h3><strong>Conclusions and Implications:</strong></h3><ul>
<li>The findings provide valuable insights into <strong>the structural evolution of human chromosome 2</strong>, which played a crucial role in human speciation.</li>
<li>Understanding these <strong>segmental duplications</strong> and their evolutionary trajectories sheds light on <strong>genomic instability</strong>, which may contribute to <strong>human genetic diseases</strong>.</li>
<li>The study highlights how large-scale chromosomal rearrangements, such as fusion and duplication, have influenced the <strong>evolutionary divergence of humans</strong> from other primates.</li>
</ul><p>This research advances our understanding of <strong>human genome evolution</strong> and offers a foundation for studying the effects of <strong>structural variants in genetic disorders</strong>.</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/3918/the-human-genome-project-video-3d-animation-introduction-low</guid>
	<pubDate>Sat, 24 Aug 2013 19:01:19 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/3918/the-human-genome-project-video-3d-animation-introduction-low</link>
	<title><![CDATA[The Human Genome Project Video   3D Animation Introduction Low)]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/YxoQFSBwyms" frameborder="0" allowfullscreen></iframe>]]></description>
	
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/7214/lapti-lab</guid>
  <pubDate>Thu, 12 Dec 2013 18:19:12 -0600</pubDate>
  <link></link>
  <title><![CDATA[LAPTI Lab]]></title>
  <description><![CDATA[
<p>The main theme of our research is the understanding of how genetic information is decoded from DNA into RNA and proteins. Someone may find this topic a little strange and argue that we already know how this is happening.</p>

<p>Translational recoding. </p>

<p>RNA editing. </p>

<p>Evolution of the genetic code and translation.</p>

<p>More at http://lapti.ucc.ie/research.html</p>

<p>Lab page http://lapti.ucc.ie/index.html</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/25987/chekulaevalab</guid>
  <pubDate>Tue, 12 Jan 2016 02:32:03 -0600</pubDate>
  <link></link>
  <title><![CDATA[Chekulaevalab]]></title>
  <description><![CDATA[
<p>Focusing on understanding the molecular mechanisms that regulate mRNA translation, localization and stability and role of non-coding RNAs in this process. Up to 90% of human DNA is estimated to be transcribed into so called non-coding RNAs that are not translated into proteins. Many of them act as potent modifiers of gene expression. miRNAs are a class of such short non-coding RNAs. They regulate expression of more than a half of eukaryotic genes, thus, affecting multiple biological processes, including cell proliferation, differentiation, apoptosis and senescence. Not surprisingly, miRNAs are involved in many human pathologies, including cancer and neurological disorders and hold great potential as drug targets, disease markers, as well as therapeutic agents.<br />Our lab is located at the Berlin Institute for Medical Systems Biology (BIMSB), a part of the Max Delbrück Center for Molecular Medicine (MDC).</p>

<p>http://www.chekulaevalab.org/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39372/irnad-a-computational-tool-for-identifying-d-modification-sites-in-rna-sequence</guid>
	<pubDate>Thu, 16 May 2019 00:20:07 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39372/irnad-a-computational-tool-for-identifying-d-modification-sites-in-rna-sequence</link>
	<title><![CDATA[iRNAD: a computational tool for identifying D modification sites in RNA sequence]]></title>
	<description><![CDATA[<p><span>iRNAD, for identifying D modification sites in RNA sequence. In this predictor, the RNA samples derived from five species were encoded by nucleotide chemical property and nucleotide density. Support vector machine was utilized to perform the classification.&nbsp;</span></p>
<p><span><a href="http://lin-group.cn/server/iRNAD/">http://lin-group.cn/server/iRNAD/</a></span></p><p>Address of the bookmark: <a href="http://lin-group.cn/server/iRNAD/" rel="nofollow">http://lin-group.cn/server/iRNAD/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41825/hnadock-a-nucleic-acid-docking-server-for-modeling-rnadna%E2%80%93rnadna-3d-complex-structures</guid>
	<pubDate>Thu, 04 Jun 2020 23:19:07 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41825/hnadock-a-nucleic-acid-docking-server-for-modeling-rnadna%E2%80%93rnadna-3d-complex-structures</link>
	<title><![CDATA[HNADOCK: a nucleic acid docking server for modeling RNA/DNA–RNA/DNA 3D complex structures]]></title>
	<description><![CDATA[<p><span>The HNADOCK server is to predict the binding complex structure between two nucleic acid molecules through a hierarchical docking algorihtm of an FFT-based global search strategy and an intrinsic scoring function for nucleic acid interactions. Users are required to provide the three-dimensional (3D) structures of the two molecules to be docked.&nbsp;</span></p><p>Address of the bookmark: <a href="http://huanglab.phys.hust.edu.cn/hnadock/" rel="nofollow">http://huanglab.phys.hust.edu.cn/hnadock/</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44616/basics-of-blast-programs</guid>
	<pubDate>Fri, 26 Jul 2024 06:04:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44616/basics-of-blast-programs</link>
	<title><![CDATA[Basics of BLAST Programs !]]></title>
	<description><![CDATA[<p>The Basic Local Alignment Search Tool (BLAST) is a powerful bioinformatics program used to compare an input sequence (such as DNA, RNA, or protein sequences) against a database of sequences to find regions of similarity. Developed by the National Center for Biotechnology Information (NCBI), BLAST is widely used for identifying species, finding functional and evolutionary relationships between sequences, and predicting the function of novel sequences.</p><p>Key Features of BLAST:<br />1. Sequence Comparison: BLAST searches for local alignments between the query sequence and sequences in a database. It identifies regions of similarity, which can help infer functional and evolutionary relationships.</p><p>2. Speed and Efficiency: BLAST uses heuristic algorithms, making it faster than exhaustive search methods, suitable for large-scale database searches.</p><p>3. Versatility: There are several versions of BLAST for different types of sequence comparisons:<br /> - blastn: Compares a nucleotide query sequence against a nucleotide sequence database.<br /> - blastp: Compares a protein query sequence against a protein sequence database.<br /> - blastx: Compares a nucleotide query sequence translated in all reading frames against a protein sequence database.<br /> - tblastn: Compares a protein query sequence against a nucleotide sequence database translated in all reading frames.<br /> - tblastx: Compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.</p><p>4. Scoring and E-value: BLAST results are scored based on the quality and length of the alignments. The E-value (expect value) indicates the number of alignments one can expect to find by chance, with lower E-values representing more significant matches.</p><p>5. Output Formats: BLAST provides results in various formats, including plain text, HTML, XML, and JSON, making it adaptable for different types of analyses and integrations with other tools.</p><p>Applications of BLAST:<br />- Genomic Research: Identifying genes, understanding genetic diversity, and mapping genome sequences.<br />- Protein Function Prediction: Inferring the function of unknown proteins by comparing them to known protein sequences.<br />- Evolutionary Studies: Exploring evolutionary relationships between organisms by comparing their genetic material.<br />- Medical Research: Identifying pathogens, understanding disease mechanisms, and developing treatments by comparing sequences of interest.</p><p>Overall, BLAST is an essential tool in bioinformatics, offering a reliable and efficient way to analyze and interpret biological sequence data.</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>

</channel>
</rss>