<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/43243?offset=0</link>
	<atom:link href="https://bioinformaticsonline.com/related/43243?offset=0" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/10925/a-brief-bioinformatics-tutorial</guid>
	<pubDate>Wed, 21 May 2014 12:50:09 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/10925/a-brief-bioinformatics-tutorial</link>
	<title><![CDATA[A Brief Bioinformatics Tutorial]]></title>
	<description><![CDATA[<p>This is about how to use a computer to find what is known about a gene of interest and also how to get new insights about it.</p>
<p>The tutorial is divided in three main parts:</p>
<ul>
<li>In the <strong>Sequence </strong>part, you will see how to look efficiently for a particular protein sequence, how to blast it against the database of your choice to find homologues, how to perform a multiple alignment of the homologues you've selected and how to edit this alignment.</li>
<li>The <strong>Structure </strong>part is about molecular visualization, homology modeling and structural domain prediction.</li>
<li>In the <strong>Function </strong>part, you will be introduced to you 3 useful servers to investigate the function of a protein. i.e. finding interactors, co-expressed genes, see a phylogenetic profile, easily access papers citing your gene etc ...</li>
</ul>
<p>During all the three parts, we will use the <em>S. cerevisiae </em>VPS36 protein as an example.</p><p>Address of the bookmark: <a href="http://www.mrc-lmb.cam.ac.uk/rlw/text/bioinfo_tuto/introduction.html" rel="nofollow">http://www.mrc-lmb.cam.ac.uk/rlw/text/bioinfo_tuto/introduction.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44279/bioinformatics-training-material</guid>
	<pubDate>Sat, 18 Mar 2023 11:26:18 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44279/bioinformatics-training-material</link>
	<title><![CDATA[Bioinformatics Training Material !]]></title>
	<description><![CDATA[<p><span>Glittr</span>&nbsp;is a curated list of bioinformatics training material.<br>All material is:</p>
<ul>
<li>In a GitHub or GitLab repository</li>
<li>Free to use</li>
<li>Written in markdown or similar</li>
</ul>
<p><span>NOTE:</span>&nbsp;This list of courses is selected only based on the above criteria.<br>There are no checks on quality.</p>
<p>https://glittr.org/?per_page=25&amp;sort_by=stargazers&amp;sort_direction=desc</p><p>Address of the bookmark: <a href="https://glittr.org/?per_page=25&amp;sort_by=stargazers&amp;sort_direction=desc" rel="nofollow">https://glittr.org/?per_page=25&amp;sort_by=stargazers&amp;sort_direction=desc</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/14218/pimp-your-brain-bioinformatics</guid>
	<pubDate>Wed, 20 Aug 2014 22:09:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/14218/pimp-your-brain-bioinformatics</link>
	<title><![CDATA[Pimp your brain: Bioinformatics]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/KqelGy6Q8nE" frameborder="0" allowfullscreen></iframe>Jan Lisec from the Max Planck Institute of Molecular Plant Physiology explains, in this "pimp your brain" episode, what bioinformatics is and why bioinformatics is so important and indispensable for biological research.

In the video serial "Pimp your brain" scientists from the Max Planck Institute of Molecular Plant Physiology describe their research. More videos from the 'Pimp your brain' serial are available on www.youtube.com/playlist?list=PL-l9VItC9Gn2Ur2Xj6PTOAkjLUlVPbIOO

More videos are available on www.mpimp-golm.mpg.de]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42552/bioinformatics-workbook</guid>
	<pubDate>Tue, 05 Jan 2021 22:42:32 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42552/bioinformatics-workbook</link>
	<title><![CDATA[bioinformatics workbook]]></title>
	<description><![CDATA[<p><span>This books assumes that the reader has some knowledge of biology and basic understanding of the Unix command line. However, for the beginner, the appendix contains introductory material and tips/tricks for common bioinformatic problems, that is referred to for more information throughout the book.</span></p>
<p>https://bioinformaticsworkbook.org/</p><p>Address of the bookmark: <a href="https://bioinformaticsworkbook.org/" rel="nofollow">https://bioinformaticsworkbook.org/</a></p>]]></description>
	<dc:creator>biogeek</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43042/bioinformatics-in-thailand</guid>
	<pubDate>Wed, 28 Apr 2021 02:04:56 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43042/bioinformatics-in-thailand</link>
	<title><![CDATA[Bioinformatics in Thailand !]]></title>
	<description><![CDATA[<p>Our international PhD and master programs are designed for students who desire focused training in the elements of biology, computer science, and information technology needed for a successful career in the exciting new discipline of Bioinformatics &amp; Systems Biology. Students in our program will receive comprehensive training in omics analysis, database design and management, software engineering and programming (including web-based development), simulation techniques and modeling, and data integration. Each student will apply their skills to a practical project, where they will design and implement a solution to a real-world problem under the guidance of an experienced mentor in industry or academia.</p>
<p><strong>https://bioinformatics.kmutt.ac.th/about.html</strong></p>
<p>Duangrudee Tanramluk (Ajarn Wi) uses computational biology and machine learning to tackle the key to drug design problems via MANORAA webserver.</p>
<p><strong>https://mb.mahidol.ac.th/en/bioinformatics/</strong></p>
<p><strong>https://graduate.mahidol.ac.th/inter/</strong></p>
<p>This&nbsp;international&nbsp;Doctorate programme is designed to further broaden students&rsquo; knowledge in Bioinformatics and Molecular Biology to their maximum capability.&nbsp;</p>
<p><strong>http://www.mbb.psu.ac.th/programmes/phd</strong></p>
<p>Ph.D. program in Bioinformatics and Computational Biology is a joint effort of the Faculty of Science and Faculty of Medicine, Chulalongkorn University. The program has study plans for both applicants who hold a bachelor&rsquo;s degree and applicants who hold a master&rsquo;s degree in any related fields of study.</p>
<p><strong>http://www.bioinfo.sc.chula.ac.th/ph-d-program-specialization/</strong></p>
<p>Additional detail&nbsp;</p>
<p><strong>https://www.biotec.or.th/en/index.php/research/research-units/genome-technology-research-unit</strong></p>
<p><strong>https://tbrcnetwork.org/labtbrc/index.php/bioinformatics-and-chemoinformatics/</strong></p>
<p><strong>https://genomicsthailand.com/Genomic/home</strong></p><p>Address of the bookmark: <a href="https://bioinformatics.kmutt.ac.th/" rel="nofollow">https://bioinformatics.kmutt.ac.th/</a></p>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</guid>
	<pubDate>Fri, 27 Aug 2021 01:31:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</link>
	<title><![CDATA[biostarhandbook]]></title>
	<description><![CDATA[<p>Nice book collection for bioinformatician ... highly recommended.</p><p>Address of the bookmark: <a href="https://www.biostarhandbook.com/" rel="nofollow">https://www.biostarhandbook.com/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26559/microscope</guid>
	<pubDate>Fri, 04 Mar 2016 05:26:31 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26559/microscope</link>
	<title><![CDATA[Microscope]]></title>
	<description><![CDATA[<p>Microscope Platform user documentation.</p>
<p>The MicroScope platform is available at this URL:</p>
<p><a href="https://www.genoscope.cns.fr/agc/microscope">https://www.genoscope.cns.fr/agc/microscope</a></p><p>Address of the bookmark: <a href="http://microscope.readthedocs.org/en/latest/index.html" rel="nofollow">http://microscope.readthedocs.org/en/latest/index.html</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/41905/research-associate-bioinformatics-in-iisc-recruitment-2020</guid>
  <pubDate>Tue, 23 Jun 2020 21:53:34 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Associate Bioinformatics in IISc Recruitment 2020]]></title>
  <description><![CDATA[
<p>Research Associate Bioinformatics in IISc Recruitment 2020</p>

<p>Essential Qualifications: Ph.D. (Bioinformatics/ Biophysics/ Biotechnology or any other stream of biological/ physical sciences) with a minimum of two publications in reputed peer reviewed journals in the area of structural bioinformatics or biophysics or biomolecular modeling/ simulation.</p>

<p>Job description: Development of bioinformatics tools and algorithms/software for structure based analysis of biomolecular systems. Programmatic access to major biomolecular databases using APIs Knowledge based prediction and analysis of biomolecular structure, function and interactions. Docking/simulations for inhibitor design.</p>

<p>Desirable Qualifications (Research Associate/s): i)  Strong computer programming skills (in Python/PERL/PHP or C++ or object oriented database management systems like MySQL etc or scripting languages under LINUX/UNIX environment). </p>

<p>ii) Extensive experience in computational analysis of biomolecular structure/interactions and usage of advanced biomolecular simulation softwares. iii) Adequate knowledge of major databases, webservers and softwares in the area of biomolecular structure/function and drug design. iv)  Familiarity with Parallel Programming environments and experience in usage of high-end HPC clusters.</p>

<p>The candidates must highlight their experience in above mentioned fields/topics in their CV. Initial appointment will be for a period of 1 year, subject to extension after review of performance.</p>

<p>Emoluments: As per DST, GOI norms and commensurate with experience.</p>

<p>More at https://www.iisc.ac.in/positions-open/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/42814/bioinformatics-in-africa-part6-sudan</guid>
	<pubDate>Sat, 06 Feb 2021 21:20:59 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/42814/bioinformatics-in-africa-part6-sudan</link>
	<title><![CDATA[Bioinformatics in Africa: Part6 - Sudan]]></title>
	<description><![CDATA[<p>Commission&nbsp;for&nbsp;Biotechnology&nbsp;&amp;&nbsp;Genetic&nbsp;Engineering&nbsp;&shy;&nbsp;Khartoum: The&nbsp;Commission&nbsp;for&nbsp;Biotechnology&nbsp;and&nbsp;Genetic&nbsp;Engineering&nbsp;was&nbsp;established&nbsp;in&nbsp;9/2/1993&nbsp;as&nbsp; research&nbsp;unit.&nbsp;In&nbsp;addition&nbsp;to&nbsp;research&nbsp;activities&nbsp;it&nbsp;acts&nbsp;as&nbsp;focal&nbsp;point&nbsp;for&nbsp;the&nbsp;International&nbsp;Center&nbsp;for&nbsp; Biotechnology&nbsp;and&nbsp;Genetic&nbsp;Engineering. The&nbsp;commission&nbsp;conducts&nbsp;researches&nbsp;in&nbsp;order&nbsp;to&nbsp;play&nbsp;a&nbsp;part&nbsp;in&nbsp;solving&nbsp;economical,&nbsp;environmental,&nbsp; health&nbsp;and&nbsp;nutritional&nbsp;problems&nbsp;using&nbsp;modern&nbsp;research&nbsp;techniques&nbsp;with&nbsp;an&nbsp;emphasis&nbsp;on&nbsp;the&nbsp;applied&nbsp; researches&nbsp;in&nbsp;these&nbsp;areas. The&nbsp;laboratories&nbsp;were&nbsp;well&nbsp;furnished&nbsp;with&nbsp;the&nbsp;essential&nbsp;equipments&nbsp;and&nbsp;the&nbsp;catalyst&nbsp;infrastructure&nbsp;to&nbsp; facilitate&nbsp;emergence&nbsp;of&nbsp;a&nbsp;successful&nbsp;for&nbsp;research.&nbsp;The&nbsp;Commission&nbsp;equipped&nbsp;with&nbsp;a&nbsp;computer&nbsp;center&nbsp; and&nbsp;information&nbsp;to&nbsp;serve&nbsp;as&nbsp;informatics&nbsp;and&nbsp;Digital&nbsp;library.</p><p>Research&nbsp;Interest&nbsp;and&nbsp;Activities: 1. Plant&nbsp;Genetic&nbsp;Transformations<br />2. Molecular&nbsp;Population&nbsp;Genetics 3. Detection&nbsp;of&nbsp;human&nbsp;and&nbsp;Animals&nbsp;diseases 4. Breast&nbsp;Cancer&shy;specific&nbsp;protein&nbsp;marker 5. Phytochemical 6. Genomic&nbsp;map 7. Bioremediation 8. Tissue&nbsp;Culture.</p><p>Web&nbsp;site&nbsp;and&nbsp;links: www.geocity.cbge.com</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

</channel>
</rss>