BOL: Related items

Liftoff: an accurate tool that maps annotations in GFF or GTF between assemblies

Jit — Tue, 30 Jun 2020 21:40:52 -0500

Liftoff, an accurate tool that maps annotations in GFF or GTF between assemblies of the same, or closely-related species. Unlike current coordinate lift-over tools which require a pre-generated “chain” file as input, Liftoff is a standalone tool that takes two genome assemblies and a reference annotation as input and outputs an annotation of the target genome.

Address of the bookmark: https://github.com/agshumate/Liftoff

Clustergrammer is a web-based tool for visualizing high-dimensional data as an interactive and shareable hierarchically clustered heatmap

BioStar — Sun, 23 Aug 2020 19:30:17 -0500

Clustergrammer is a web-based tool for visualizing high-dimensional data (e.g. a matrix) as an interactive and shareable hierarchically clustered heatmap. Clustergrammer's front end (Clustergrammer-JS) is built using D3.js and its back-end (Clustergrammer-PY) is built using Python. Clustergrammer produces highly interactive visualizations that enable intuitive exploration of high-dimensional data and has several biology-specific features (e.g. enrichment analysis, see Biology-Specific Features) to facilitate the exploration of gene-level biological data.

Address of the bookmark: https://github.com/MaayanLab/clustergrammer

LoReTTA, a user-friendly tool for assembling viral genomes from PacBio sequence data

Neel — Wed, 23 Jun 2021 07:54:53 -0500

LoReTTA (Long Read Template-Targeted Assembler), a tool designed for performing de novo assembly of long reads generated from viral genomes on the PacBio platform. LoReTTA exploits a reference genome to guide the assembly process, an approach that has been successful with short reads.

https://academic.oup.com/ve/article/7/1/veab042/6248116

Address of the bookmark: https://academic.oup.com/ve/article/7/1/veab042/6248116

InteractiVenn: a web-based tool for the analysis of sets through Venn diagrams

Jit — Wed, 29 Jun 2022 03:22:26 -0500

InteractiVenn, a more flexible tool for interacting with Venn diagrams including up to six sets. It offers a clean interface for Venn diagram construction and enables analysis of set unions while preserving the shape of the diagram. Set unions are useful to reveal differences and similarities among sets and may be guided in our tool by a tree or by a list of set unions. The tool also allows obtaining subsets’ elements, saving and loading sets for further analyses, and exporting the diagram in vector and image formats. InteractiVenn has been used to analyze two biological datasets, but it may serve set analysis in a broad range of domains.

More at https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-015-0611-3

Address of the bookmark: http://www.interactivenn.net/

Minda: a tool for evaluating structural variant (SV) callers

LEGE — Sun, 31 Mar 2024 02:43:50 -0500

Minda is a tool for evaluating structural variant (SV) callers that

standardizes VCF records for compatibility with both germline and somatic SV callers,
benchmarks against a single VCF input file, or
benchmarks against an ensemble call set created from multiple VCF input files.

Address of the bookmark: https://github.com/KolmogorovLab/minda

LoVis4u: Locus Visualisation tool for comparative genomics

LEGE — Tue, 17 Sep 2024 02:30:57 -0500

Description

LoVis4u is a bioinformatics tool for Loci Visualisation.

LoVis4u, a command-line tool and Python API designed for highly customizable and fast visualisation of multiple genomic loci. LoVis4u generates vector images in PDF format based on annotation data from GenBank or GFF files. It is capable of visualising entire genomes of bacteriophages as well as plasmids and user-defined regions of longer prokaryotic genomes. Additionally, LoVis4u offers optional data processing steps to identify and highlight accessory and core genes in input sequences.

https://art-egorov.github.io/lovis4u/

Address of the bookmark: https://github.com/art-egorov/lovis4u

MIKE: an ultrafast, assembly-, and alignment-free approach for phylogenetic tree construction

Abhi — Mon, 08 Apr 2024 06:19:52 -0500

MIKE (MinHash-based k-mer algorithm). This algorithm is designed for the swift calculation of the Jaccard coefficient directly from raw sequencing reads and enables the construction of phylogenetic trees based on the resultant Jaccard coefficient. Simulation results highlight the superior speed of MIKE compared to existing state-of-the-art methods. We used MIKE to reconstruct a phylogenetic tree, incorporating 238 yeast, 303 Zea, 141 Ficus, 67 Oryza, and 43 Saccharum spontaneum samples. MIKE demonstrated accurate performance across varying evolutionary scales, reproductive modes, and ploidy levels, proving itself as a powerful tool for phylogenetic tree construction.

Address of the bookmark: https://github.com/Argonum-Clever2/mike

Graph Genome Suite

Jit — Fri, 28 Oct 2016 07:59:54 -0500

Seven Bridges is the biomedical data analysis company accelerating breakthroughs in genomics research for cancer, drug development and precision medicine. We build self-improving systems to analyze millions of genomes, including the Graph Genome Suite — the most advanced population genomics tools in the world.

Address of the bookmark: https://www.sbgenomics.com/graph/

Rectangle Graph for Repeat Resolution in Genome Assembly

Rahul Nayak — Thu, 28 Dec 2017 09:43:03 -0600

Ultimate tool for resolving repeats in genome assemblies.

Though the specific implementation of the idea of the rectangle graph approach is already included into the current SPAdes distribution, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.

For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner. From de Bruijn Graphs to Rectangle Graphs for Genome Assembly, Lecture Notes in Bioinformatics 7534 (2012), pp. 249-261.

Address of the bookmark: http://bioinf.spbau.ru/en/rectangles

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia