BOL: Related items

Graph Genome Suite

Jit — Fri, 28 Oct 2016 07:59:54 -0500

Seven Bridges is the biomedical data analysis company accelerating breakthroughs in genomics research for cancer, drug development and precision medicine. We build self-improving systems to analyze millions of genomes, including the Graph Genome Suite — the most advanced population genomics tools in the world.

Address of the bookmark: https://www.sbgenomics.com/graph/

Rectangle Graph for Repeat Resolution in Genome Assembly

Rahul Nayak — Thu, 28 Dec 2017 09:43:03 -0600

Ultimate tool for resolving repeats in genome assemblies.

Though the specific implementation of the idea of the rectangle graph approach is already included into the current SPAdes distribution, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.

For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner. From de Bruijn Graphs to Rectangle Graphs for Genome Assembly, Lecture Notes in Bioinformatics 7534 (2012), pp. 249-261.

Address of the bookmark: http://bioinf.spbau.ru/en/rectangles

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

ChopStitch: exon annotation and splice graph construction using transcriptome assembly and whole genome sequencing data

Rahul Nayak — Tue, 03 Jul 2018 04:14:52 -0500

ChopStitch is a new method for finding putative exons and constructing splice graphs using an assembled transcriptome and whole genome shotgun sequencing (WGSS) data. ChopStitch identifies exon-exon boundaries in de novo assembled RNA-seq data with the help of a Bloom filter that represents the k-mer spectrum of WGSS reads. The algorithm also detects base substitutions in transcript sequences corresponding to sequencing or assembly errors, haplotype variations, or putative RNA editing events. The primary output of our tool is a FASTA file containing putative exons. Further, exon edges are interrogated for alternative exon-exon boundaries to detect transcript isoforms, which are reported as splice graphs in dot output format.

Address of the bookmark: https://github.com/bcgsc/ChopStitch

GraphUnzip: Phases an assembly graph using Hi-C data and/or long reads.

Jit — Fri, 05 Feb 2021 21:22:24 -0600

GraphUnzip, a fast, memory-efficient and accurate tool to unzip assembly graphs into their constituent haplotypes using long reads and/or Hi-C data. As GraphUnzip only connects sequences in the assembly graph that already had a potential link based on overlaps, it yields high-quality gap-less supercontigs. To demonstrate the efficiency of GraphUnzip, we tested it on a simulated diploid Escherichia coli genome, and on two real datasets for the genomes of the rotifer Adineta vaga and the potato Solanum tuberosum. In all cases, GraphUnzip yielded highly continuous phased assemblies.

https://www.biorxiv.org/content/biorxiv/early/2021/02/01/2021.01.29.428779.full.pdf

Address of the bookmark: https://github.com/nadegeguiglielmoni/GraphUnzip

GFAffix : Identifies walk-preserving shared affixes in variation graphs and collapses them into a non-redundant graph structure.

BioStar — Thu, 28 Aug 2025 03:11:25 -0500

GFAffix identifies walk-preserving shared affixes in variation graphs and collapses them into a non-redundant graph structure.

Address of the bookmark: https://github.com/codialab/GFAffix

Easyfig

Poonam Mahapatra — Fri, 29 Apr 2016 05:49:39 -0500

Easyfig has moved to github, for newer releases of Easyfig please visit our new webpage - https://mjsull.github.io/Easyfig. Easyfig is a Python application for creating linear comparison figures of multiple genomic loci with an easy-to-use graphical user interface (GUI).

More at http://easyfig.sourceforge.net/

Address of the bookmark: http://easyfig.sourceforge.net/

Release Notes for Genome Workbench 2.10.5

Jit — Thu, 12 May 2016 13:49:41 -0500

New Features in latest release

New ProSplign tool integrated with Genome Workbench (Tutorial, Video)
New export function for BAM/cSRA coverage graphs (Tutorial)
New export function for alignments GFF3 format ((Tutorial))
Tree View: implemented new export mode based on selections (tutorial coming)
Tree View: added support for distance based circular trees
Tree View: new rooting mode (Midpoint Root) results in more balanced trees (Tutorial)
Tree View: added possibility to right-click on an edge between two nodes and "Place Root at Middle of Branch" – to re-root at mid-branch (Tutorial)

GKNO

Neel — Fri, 20 May 2016 18:56:37 -0500

gkno opens the world of complex bioinformatic analysis to people of all level of computational expertise. This site contains documentation, tutorials and information on all the tools that comprise gkno.

http://gkno.me/how-to/install.html

http://gkno.me/software.html

Address of the bookmark: http://gkno.me/

LoRMA: a tool for correcting sequencing errors in long reads such those produced by Pacific Biosciences sequencing machines

Jit — Wed, 15 Jun 2016 17:18:36 -0500

LoRMA is a tool for correcting sequencing errors in long reads such those produced by Pacific Biosciences sequencing machines.

Publication:

L. Salmela, R. Walve, E. Rivals, and E. Ukkonen: Accurate selfcorrection of errors in long reads using de Bruijn graphs. Accepted to RECOMB-Seq 2016.

Download:

Address of the bookmark: https://www.cs.helsinki.fi/u/lmsalmel/LoRMA/