<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/43315?offset=380</link>
	<atom:link href="https://bioinformaticsonline.com/related/43315?offset=380" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</guid>
	<pubDate>Thu, 26 Jul 2018 04:58:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</link>
	<title><![CDATA[My commonly used commands in Bioinformatics]]></title>
	<description><![CDATA[<p>FYI, I've found it useful to use MUMmer to extract the specific changes that Racon makes, so I can evaluate them individually:</p><pre><code>minimap -t 24 assembly.fasta long_reads.fastq.gz | racon -t 24 long_reads.fastq.gz - assembly.fasta racon_assembly.fasta
nucmer -p nucmer assembly.fasta racon_assembly.fasta
show-snps -C -T -r nucmer.delta
</code></pre><p>This reports Racon's changes in a table. You can exclude indels with the&nbsp;<code>-I</code>&nbsp;option in&nbsp;<code>show-snps</code>.&nbsp;</p><p>This process (Racon -&gt; MUMmer -&gt; SNP table) solves the problem I originally raised in this issue. So as far as I'm concerned, you can close this issue (or keep it open if you still want to implement some kind of variant table).</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</guid>
	<pubDate>Thu, 25 Oct 2018 09:38:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</link>
	<title><![CDATA[Scribl : HTML5 canvas genomics graphic library]]></title>
	<description><![CDATA[<p>Scribl is a javascript, Canvas-based graphics library that easily generates biological visuals of genomic regions, alignments, and assembly data. Scribl can also be used in conventional offline pipelines, since everything needed to generate charts can be contained in a single html file.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://chmille4.github.io/Scribl/" rel="nofollow">http://chmille4.github.io/Scribl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38166/pygenometracks-standalone-program-and-library-to-plot-beautiful-genome-browser-tracks</guid>
	<pubDate>Fri, 09 Nov 2018 12:34:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38166/pygenometracks-standalone-program-and-library-to-plot-beautiful-genome-browser-tracks</link>
	<title><![CDATA[pyGenomeTracks: Standalone program and library to plot beautiful genome browser tracks]]></title>
	<description><![CDATA[<p>pyGenomeTracks aims to produce high-quality genome browser tracks that are highly customizable. Currently, it is possible to plot:</p>
<ul>
<li>bigwig</li>
<li>bed (many options)</li>
<li>bedgraph</li>
<li>links (represented as arcs)</li>
<li>Hi-C matrices (if&nbsp;<a href="http://hicexplorer.readthedocs.io/">HiCExplorer</a>&nbsp;is installed)</li>
</ul><p>Address of the bookmark: <a href="https://github.com/deeptools/pyGenomeTracks" rel="nofollow">https://github.com/deeptools/pyGenomeTracks</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41831/merqury-reference-free-quality-and-phasing-assessment-for-genome-assemblies</guid>
	<pubDate>Sat, 06 Jun 2020 05:38:34 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41831/merqury-reference-free-quality-and-phasing-assessment-for-genome-assemblies</link>
	<title><![CDATA[Merqury: reference-free quality and phasing assessment for genome assemblies]]></title>
	<description><![CDATA[<p><span>Often, genome assembly projects have illumina whole genome sequencing reads available for the assembled individual. The k-mer spectrum of this read set can be used for independently evaluating assembly quality without the need of a high quality reference. Merqury provides a set of tools for this purpose.</span></p>
<p><span><a href="https://github.com/marbl/meryl">https://github.com/marbl/meryl</a></span></p><p>Address of the bookmark: <a href="https://github.com/marbl/merqury" rel="nofollow">https://github.com/marbl/merqury</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38561/hawkeye-an-interactive-visual-analytics-tool-for-genome-assemblies</guid>
	<pubDate>Tue, 01 Jan 2019 11:56:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38561/hawkeye-an-interactive-visual-analytics-tool-for-genome-assemblies</link>
	<title><![CDATA[Hawkeye: an interactive visual analytics tool for genome assemblies]]></title>
	<description><![CDATA[<p><span>Genome sequencing remains an inexact science, and genome sequences can contain significant errors if they are not carefully examined. Hawkeye is our new visual analytics tool for genome assemblies, designed to aid in identifying and correcting assembly errors. Users can analyze all levels of an assembly along with summary statistics and assembly metrics, and are guided by a ranking component towards likely mis-assemblies. Hawkeye is freely available and released as part of the open source AMOS project&nbsp;</span><span><a href="http://amos.sourceforge.net/hawkeye"><span>http://amos.sourceforge.net/hawkeye</span></a></span><span>.</span></p>
<p>https://genomebiology.biomedcentral.com/articles/10.1186/gb-2007-8-3-r34</p><p>Address of the bookmark: <a href="http://amos.sourceforge.net/wiki/index.php?title=Hawkeye" rel="nofollow">http://amos.sourceforge.net/wiki/index.php?title=Hawkeye</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39236/causel-an-epigenome-and-genome-editing-pipeline-for-establishing-function-of-noncoding-gwas-variants</guid>
	<pubDate>Tue, 09 Apr 2019 07:23:37 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39236/causel-an-epigenome-and-genome-editing-pipeline-for-establishing-function-of-noncoding-gwas-variants</link>
	<title><![CDATA[CAUSEL: an epigenome- and genome-editing pipeline for establishing function of noncoding GWAS variants]]></title>
	<description><![CDATA[<p><span>Validated a widely accessible approach that can be used to establish functional causality for noncoding sequence variants identified by GWASs.</span></p>
<p><a href="https://www.nature.com/articles/nm.3975">https://www.nature.com/articles/nm.3975</a></p><p>Address of the bookmark: <a href="https://www.nature.com/articles/nm.3975" rel="nofollow">https://www.nature.com/articles/nm.3975</a></p>]]></description>
	<dc:creator>BioJoker</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39903/integrative-meta-assembly-pipeline-imap-chromosome-level-genome-assembler-combining-multiple-de-novo-assemblies</guid>
	<pubDate>Sat, 31 Aug 2019 11:30:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39903/integrative-meta-assembly-pipeline-imap-chromosome-level-genome-assembler-combining-multiple-de-novo-assemblies</link>
	<title><![CDATA[Integrative Meta-Assembly Pipeline (IMAP): Chromosome-level genome assembler combining multiple de novo assemblies]]></title>
	<description><![CDATA[<p><span>Chromosome-level genome assembler combining multiple de novo assemblies</span></p>
<p><span><a href="https://github.com/jkimlab/IMAP">https://github.com/jkimlab/IMAP</a></span></p><p>Address of the bookmark: <a href="https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0221858" rel="nofollow">https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0221858</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/40881/liu-lab</guid>
  <pubDate>Tue, 04 Feb 2020 06:27:02 -0600</pubDate>
  <link></link>
  <title><![CDATA[Liu Lab]]></title>
  <description><![CDATA[
<p>Shirley is a computational biologist with expertise in cancer epigenetics. Her research focuses on algorithm development and integrative mining from big data generated on microarrays, massively parallel sequencing, and other high throughput techniques to model the specificity and function of transcription factors, chromatin regulators and lncRNAs in tumor development, progression, drug response and resistance.</p>

<p>https://liulab-dfci.github.io/software/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41464/phytozome-v121-plant-science-community-hub-for-accessing-palnts-genomic-data</guid>
	<pubDate>Tue, 17 Mar 2020 07:30:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41464/phytozome-v121-plant-science-community-hub-for-accessing-palnts-genomic-data</link>
	<title><![CDATA[Phytozome  v12.1: plant science community hub for accessing palnts genomic data]]></title>
	<description><![CDATA[<p>Phytozome, the Plant Comparative Genomics portal of the Department of Energy's Joint Genome Institute, provides JGI users and the broader plant science community a hub for accessing, visualizing and analyzing JGI-sequenced plant genomes, as well as selected genomes and datasets that have been sequenced elsewhere. As of release v12.1.6, Phytozome hosts 93 assembled and annotated genomes, from 82 Viridiplantae species. More than half of these genomes have been sequenced, assembled and/or annotated with JGI Plant Science program resources. By integrating this large collection of plant genomes into a single resource and performing comprehensive and uniform annotation and analyses, Phytozome facilitates accurate and insightful comparative genomics studies.</p><p>Address of the bookmark: <a href="https://phytozome.jgi.doe.gov/pz/portal.html" rel="nofollow">https://phytozome.jgi.doe.gov/pz/portal.html</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>

</channel>
</rss>