<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/43364?offset=110</link>
	<atom:link href="https://bioinformaticsonline.com/related/43364?offset=110" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/4288/new-born-babies-get-ready-to-know-their-whole-genome-soon</guid>
	<pubDate>Thu, 05 Sep 2013 07:24:02 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/4288/new-born-babies-get-ready-to-know-their-whole-genome-soon</link>
	<title><![CDATA[New born babies get ready to know their whole genome soon!!!]]></title>
	<description><![CDATA[<p>USA launch a pilot projects to examine medical information of newborn baby, which are being funded by the Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD) and the National Human Genome Research Institute (NHGRI), both parts of the National Institutes of Health.</p><p>Awards of $5 million to four grantees have been made in fiscal year 2013 under the Genomic Sequencing and Newborn Screening Disorders research program. The program will be funded at $25 million over five years, as funds are made available.</p><p>"Hundreds of US babies will be pioneers in genomic medicine through a&nbsp;US$25-million programme to sequence their genomes&nbsp;soon after they are born."</p><p><strong>Source</strong>:</p><p><a href="http://blogs.nature.com/news/2013/09/scientists-to-sequence-hundreds-of-newborns-genomes.html">http://blogs.nature.com/news/2013/09/scientists-to-sequence-hundreds-of-newborns-genomes.html</a></p><p><a href="http://www.genome.gov/27554919">http://www.genome.gov/27554919</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33976/goldgenomes-online-database</guid>
	<pubDate>Wed, 26 Jul 2017 07:49:29 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33976/goldgenomes-online-database</link>
	<title><![CDATA[GOLD:Genomes Online Database]]></title>
	<description><![CDATA[<p><span>GOLD</span><span>:Genomes Online Database, is a World Wide Web resource for comprehensive access to information regarding genome and metagenome sequencing projects, and their associated metadata, around the world.</span></p>
<p>https://gold.jgi.doe.gov/</p><p>Address of the bookmark: <a href="https://gold.jgi.doe.gov/" rel="nofollow">https://gold.jgi.doe.gov/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34413/coursera-genome-assembly-tutorial</guid>
	<pubDate>Sat, 25 Nov 2017 08:57:25 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34413/coursera-genome-assembly-tutorial</link>
	<title><![CDATA[coursera genome assembly tutorial]]></title>
	<description><![CDATA[<p><span>Solutions to Coursera Genome Sequencing (Bioinformatics II)</span></p><p>Address of the bookmark: <a href="https://github.com/iansealy/coursera-assembly" rel="nofollow">https://github.com/iansealy/coursera-assembly</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34528/cope-an-accurate-k-mer-based-pair-end-reads-connection-tool-to-facilitate-genome-assembly</guid>
	<pubDate>Wed, 06 Dec 2017 02:08:14 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34528/cope-an-accurate-k-mer-based-pair-end-reads-connection-tool-to-facilitate-genome-assembly</link>
	<title><![CDATA[COPE: an accurate k-mer-based pair-end reads connection tool to facilitate genome assembly]]></title>
	<description><![CDATA[<p><span>An efficient tool called Connecting Overlapped Pair-End (COPE) reads, to connect overlapping pair-end reads using k-mer frequencies. We evaluated our tool on 30&times; simulated pair-end reads from Arabidopsis thaliana with 1% base error. COPE connected over 99% of reads with 98.8% accuracy, which is, respectively, 10 and 2% higher than the recently published tool FLASH. When COPE is applied to real reads for genome assembly, the resulting contigs are found to have fewer errors and give a 14-fold improvement in the N50 measurement when compared with the contigs produced using unconnected reads.</span></p><p>Address of the bookmark: <a href="ftp://ftp.genomics.org.cn/pub/cope" rel="nofollow">ftp://ftp.genomics.org.cn/pub/cope</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34867/magic-blast-a-tool-for-mapping-large-next-generation-rna-or-dna-sequencing-runs-against-a-whole-genome-or-transcriptome</guid>
	<pubDate>Tue, 26 Dec 2017 22:23:39 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34867/magic-blast-a-tool-for-mapping-large-next-generation-rna-or-dna-sequencing-runs-against-a-whole-genome-or-transcriptome</link>
	<title><![CDATA[Magic-BLAST: a tool for mapping large next-generation RNA or DNA sequencing runs against a whole genome or transcriptome.]]></title>
	<description><![CDATA[<p>Magic-BLAST is a tool for mapping large next-generation RNA or DNA sequencing runs against a whole genome or transcriptome. Each alignment optimizes a composite score, taking into account simultaneously the two reads of a pair, and in case of RNA-seq, locating the candidate introns and adding up the score of all exons. This is very different from other versions of BLAST, where each exon is scored as a separate hit and read-pairing is ignored.</p>
<p>Magic-BLAST incorporates within the NCBI BLAST code framework ideas developed in the NCBI Magic pipeline, in particular hit extensions by local walk and jump&nbsp;<a href="http://www.ncbi.nlm.nih.gov/pubmed/26109056">(http://www.ncbi.nlm.nih.gov/pubmed/26109056)</a>, and recursive clipping of mismatches near the edges of the reads, which avoids accumulating artefactual mismatches near splice sites and is needed to distinguish short indels from substitutions near the edges.</p><p>Address of the bookmark: <a href="https://ncbi.github.io/magicblast/" rel="nofollow">https://ncbi.github.io/magicblast/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37650/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Fri, 07 Sep 2018 05:19:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37650/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[<p><span>P_RNA_scaffolder is a novel scaffolding tool using Pair-end RNA-seq to scaffold genome fragments. The method is suitable for most genomes. The program could utilize Illumina Paired-end RNA-sequencing reads from target speciesies. Our method provides another practical alternative to existing mate-pair_based approaches or other Protein-based approaches (for instance,&nbsp;</span><a href="http://www.fishbrowser.org/software/PEP_scaffolder/">PEP_scaffolder&nbsp;</a><span>) for scaffolding genome sequences. The most important feature of this method is to improve the completeness of gene regions and long-coding gene regions (for instance,&nbsp;</span><a href="http://circrna.org/">circRNA</a><span>).</span></p><p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/#" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/#</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

</channel>
</rss>