<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/43614?offset=500</link>
	<atom:link href="https://bioinformaticsonline.com/related/43614?offset=500" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40940/consed-a-finishing-package-bam-file-viewer-assembly-editor-autofinish-autoreport-autoedit-and-align-reads-to-reference-sequence</guid>
	<pubDate>Fri, 07 Feb 2020 07:16:22 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40940/consed-a-finishing-package-bam-file-viewer-assembly-editor-autofinish-autoreport-autoedit-and-align-reads-to-reference-sequence</link>
	<title><![CDATA[Consed--A Finishing Package (BAM File Viewer, Assembly Editor, Autofinish, Autoreport, Autoedit, and Align Reads To Reference Sequence)]]></title>
	<description><![CDATA[<ul>
<li>Supports Illumina, 454, other Next-Gen and Sanger Reads and allows mixtures of these read types</li>
<li>Consed includes BamScape which can view bam files with unlimited numbers of reads. BamScape can bring up consed to edit reads and the reference sequence in targeted regions.</li>
<li>Consed is compatible with Newbler, Cross_match, Phrap, MIRA, Velvet and PCAP output.</li>
<li>Quickly takes the user to each variant site for viewing (also available as an automated report)</li>
<li>Overview of assembly can help detect and fix misassemblies</li>
<li>Editing time reduced by the program's ability to pin-point problem areas</li>
<li>Editing is guided by error probabilities</li>
</ul><p>Address of the bookmark: <a href="http://www.phrap.org/consed/consed.html" rel="nofollow">http://www.phrap.org/consed/consed.html</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/43913/lsugenomics-lab</guid>
  <pubDate>Thu, 07 Jul 2022 05:26:37 -0500</pubDate>
  <link></link>
  <title><![CDATA[lsugenomics Lab]]></title>
  <description><![CDATA[
<p>﻿In our lab, we seek to characterize and to compare genomes in order to better understand genetic and evolutionary processes linking genotypes to phenotypes.  <br /> <br />Sequencing and decoding plant genomes have been integral in our approaches.</p>

<p>The overarching goal of our research is to understand how to interpret complex and fascinating messages embedded in genomes.</p>

<p>https://www.lsugenomics.org/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/4590/tigers-genome-sequenced</guid>
	<pubDate>Tue, 17 Sep 2013 16:48:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/4590/tigers-genome-sequenced</link>
	<title><![CDATA[Tigers genome sequenced]]></title>
	<description><![CDATA[<p>Fifteen scientists led by Dr Jong Bhak of Genome Research Foundation, South Korea, decoded as many as 3 billion nucleotides (organic molecules that form the basic building blocks of nucleic acids, such as DNA). They identified 20,000 genes related to various functions of the tiger.&nbsp;</p><p>The biggest and perhaps most fearsome of the world's big cats, the tiger, shares 95.6 percent of its DNA with humans' cute and furry companions, domestic cats.</p><p>The new research showed that big cats have genetic mutations that enabled them to be carnivores. The team also identified mutations that allow snow leopards to thrive at high altitudes.</p><p>Reference:</p><p><a href="http://www.nbcnews.com/science/your-cat-ferocious-tigers-share-lot-95-6-percent-their-4B11182690">http://www.nbcnews.com/science/your-cat-ferocious-tigers-share-lot-95-6-percent-their-4B11182690</a></p><p><a href="http://timesofindia.indiatimes.com/home/environment/flora-fauna/Gene-mapping-of-tiger-completed/articleshow/22671681.cms">http://timesofindia.indiatimes.com/home/environment/flora-fauna/Gene-mapping-of-tiger-completed/articleshow/22671681.cms</a></p><p>Paper:</p><p><a href="http://www.nature.com/ncomms/2013/130917/ncomms3433/full/ncomms3433.html">http://www.nature.com/ncomms/2013/130917/ncomms3433/full/ncomms3433.html</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34443/opera-an-optimal-genome-scaffolding-program</guid>
	<pubDate>Mon, 27 Nov 2017 10:18:20 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34443/opera-an-optimal-genome-scaffolding-program</link>
	<title><![CDATA[Opera: An optimal genome scaffolding program]]></title>
	<description><![CDATA[<p><span>Opera (Optimal Paired-End Read Assembler) is a sequence assembly program (</span><a href="http://en.wikipedia.org/wiki/Sequence_assembly" target="_blank">http://en.wikipedia.org/wiki/Sequence_assembly&nbsp;<img src="https://a.fsdn.com/con/img/icons/external_asset.png" alt="image" style="border: 0px;"></a><span>). It uses information from paired-end or long reads to optimally order and orient contigs assembled from shotgun-sequencing reads.</span><br><br><span>An updated version called OPERA-LG has been re-engineered with features for the assembly of large and complex genomes.</span><br><br><span>Song Gao, Denis Bertrand, Burton K. H. Chia and Niranjan Nagarajan. OPERA-LG: efficient and exact scaffolding of large, repeat-rich eukaryotic genomes with performance guarantees. Genome Biology, May 2016, doi: 10.1186/s13059-016-0951-y.</span><br><br><span>Song Gao, Wing-Kin Sung, Niranjan Nagarajan. Opera: reconstructing optimal genomic scaffolds with high-throughput paired-end sequences. Journal of Computational Biology, Sept. 2011, doi:10.1089/cmb.2011.0170.</span></p>
<p><span>https://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-0951-y</span></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/operasf/" rel="nofollow">https://sourceforge.net/projects/operasf/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34620/mash-fast-genome-and-metagenome-distance-estimation-using-minhash</guid>
	<pubDate>Tue, 12 Dec 2017 17:30:12 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34620/mash-fast-genome-and-metagenome-distance-estimation-using-minhash</link>
	<title><![CDATA[Mash: fast genome and metagenome distance estimation using MinHash]]></title>
	<description><![CDATA[<p>Mash is normally distributed as a dependency-free binary for Linux or OSX (see&nbsp;<a href="https://github.com/marbl/Mash/releases">https://github.com/marbl/Mash/releases</a>). This source distribution is intended for other operating systems or for development. Mash requires c++11 to build, which is available in and GCC &gt;= 4.8 and OSX &gt;= 10.7.</p>
<p>See&nbsp;<a href="http://mash.readthedocs.org/">http://mash.readthedocs.org</a>&nbsp;for more information.</p><p>Address of the bookmark: <a href="https://github.com/marbl/Mash/releases" rel="nofollow">https://github.com/marbl/Mash/releases</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</guid>
	<pubDate>Wed, 07 Feb 2018 10:44:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</link>
	<title><![CDATA[GenomeTools: The versatile open source genome analysis software]]></title>
	<description><![CDATA[<p>The&nbsp;<em>GenomeTools</em>&nbsp;genome analysis system is a&nbsp;<a href="http://genometools.org/license.html">free</a>&nbsp;collection of bioinformatics&nbsp;<a href="http://genometools.org/tools.html">tools</a>&nbsp;(in the realm of genome informatics) combined into a single binary named&nbsp;<em>gt</em>. It is based on a C library named &ldquo;libgenometools&rdquo; which consists of several modules.</p>
<p>If you are interested in gene prediction, have a look at&nbsp;<a href="http://genomethreader.org/" title="GenomeThreader gene prediction        software"><em>GenomeThreader</em></a>.</p><p>Address of the bookmark: <a href="http://genometools.org/" rel="nofollow">http://genometools.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</guid>
	<pubDate>Tue, 08 May 2018 04:52:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</link>
	<title><![CDATA[Metassembler: merging and optimizing de novo genome assemblies]]></title>
	<description><![CDATA[<p><span>Metassembler combines multiple whole genome de novo assemblies into a combined consensus assembly using the best segments of the individual assemblies.</span></p>
<p><span><span>Genome assembly projects typically run multiple algorithms in an attempt to find the single best assembly, although those assemblies often have complementary, if untapped, strengths and weaknesses. We present our metassembler algorithm that merges multiple assemblies of a genome into a single superior sequence.&nbsp;</span></span></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/metassembler/?source=directory" rel="nofollow">https://sourceforge.net/projects/metassembler/?source=directory</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</guid>
	<pubDate>Thu, 26 Jul 2018 04:58:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</link>
	<title><![CDATA[My commonly used commands in Bioinformatics]]></title>
	<description><![CDATA[<p>FYI, I've found it useful to use MUMmer to extract the specific changes that Racon makes, so I can evaluate them individually:</p><pre><code>minimap -t 24 assembly.fasta long_reads.fastq.gz | racon -t 24 long_reads.fastq.gz - assembly.fasta racon_assembly.fasta
nucmer -p nucmer assembly.fasta racon_assembly.fasta
show-snps -C -T -r nucmer.delta
</code></pre><p>This reports Racon's changes in a table. You can exclude indels with the&nbsp;<code>-I</code>&nbsp;option in&nbsp;<code>show-snps</code>.&nbsp;</p><p>This process (Racon -&gt; MUMmer -&gt; SNP table) solves the problem I originally raised in this issue. So as far as I'm concerned, you can close this issue (or keep it open if you still want to implement some kind of variant table).</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

</channel>
</rss>