BOL: Related items

PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.

Surabhi Chaudhary — Mon, 11 Jun 2018 03:08:26 -0500

We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler. http://derisilab.ucsf.edu/software/price/

Address of the bookmark: http://derisilab.ucsf.edu/software/price/

LINKS scaffolder bloomfilter setting !

Jit — Fri, 15 Jun 2018 10:39:54 -0500

➜ bin git:(master) ✗ ls -l
total 68
drwxrwxr-x 3 urbe urbe 4096 Jun 15 12:15 lib
-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS
➜ bin git:(master) ✗ pwd
/home/urbe/Tools/LINKS_1.8.6/bin

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Converting a VCF into a FASTA given some reference !

Jit — Fri, 20 Jul 2018 10:03:53 -0500

Samtools/BCFtools (Heng Li) provides a Perl script vcfutils.pl which does this, the function vcf2fq (lines 469-528)

This script has been modified by others to convert InDels as well, e.g. this by David Eccles

./vcf2fq.pl -f <input.fasta> <all-site.vcf> > <output.fastq>

https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl

https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl

LR_Gapcloser: a tiling path-based gap closer that uses long reads to complete genome assembly

Rahul Nayak — Thu, 14 May 2020 15:09:52 -0500

LR_Gapcloser is a gap closing tool using long reads from studied species. The long reads could be downloaed from public read archive database (for instance, NCBI SRA database ) or be your own data. Then they are fragmented and aligned to scaffolds using BWA mem algorithm in BWA package. In the package, we provided a compiled bwa, so the user needn't to install bwa. LR_Gapcloser uses the alignments to find the bridging that cross the gap, and then fills the long read original sequence into the genomic gaps.

Address of the bookmark: https://github.com/CAFS-bioinformatics/LR_Gapcloser

Long read assembly workshop !

Rahul Nayak — Thu, 04 Oct 2018 17:23:18 -0500

This is a tutorial for a workshop on long-read (PacBio) genome assembly.

It demonstrates how to use long PacBio sequencing reads to assemble a bacterial genome, and includes additional steps for circularising, trimming, finding plasmids, and correcting the assembly with short-read Illumina data.

Please comment if you know any other long read addembly tutorial.

Address of the bookmark: http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/

Synima: a Synteny imaging tool for annotated genome assemblies

Abhimanyu Singh — Tue, 30 Oct 2018 10:49:13 -0500

Synima written in Perl, which uses the graphical features of R. Synima takes orthologues computed from reciprocal best BLAST hits or OrthoMCL, and DAGchainer, and outputs an overview of genome-wide synteny in PDF. Each of these programs are included with the Synima package, and a pipeline for their use. Synima has a range of graphical parameters including size, colours, order, and labels, which are specified in a config file generated by the first run of Synima – and can be subsequently edited. Synima runs quickly on a command line to generate informative and publication quality figures. Synima is open source and freely available from https://github.com/rhysf/Synima under the MIT License.

Address of the bookmark: https://github.com/rhysf/Synima

ANItools web: a web tool for fast genome comparison within multiple bacterial strains

Jit — Wed, 14 Nov 2018 04:34:23 -0600

ANItools is a software package written by PERL scripts that can be run in a Linux/Unix system. If you want to compare bacterial genomes and calculate their average nucleotide identity (ANI), you could download and run this program directly. Or you could send us the genome sequence by email. Then we will do the analysis work for you.

https://academic.oup.com/database/article/doi/10.1093/database/baw084/2630454

Address of the bookmark: http://ani.mypathogen.cn/

Genobuntu: A software package containing more than 70 software and packages oriented towards NGS and genome assembly

BioStar — Tue, 11 Dec 2018 05:15:57 -0600

Genobuntu is a software package containing more than 70 software and packages oriented towards NGS. In its current version, Genobuntu supports pre assembly tools, genome assemblers as well as post assembly tools.

Commonly used biological software and example script files for different assembly pipelines have also been provided, where the example script files can be updated to suit one’s experimental needs. Genobuntu attempts to reduce the amount of time and energy needed to build software workstations and it can also act as a good teaching source for a class room setting.

https://sourceforge.net/projects/genobuntu/

Address of the bookmark: https://sourceforge.net/projects/genobuntu/

Versatile genome assembly evaluation with QUAST-LG

Jit — Fri, 21 Dec 2018 22:06:31 -0600

QUAST-LG is an extension of QUAST intended for evaluating large-scale genome assemblies (up to mammalian-size).

QUAST-LG is included in the QUAST package starting from version 5.0.0 (download the latest release). Run QUAST as usual and do not forget to add ‐‐large option to your command!

A short list of the new features (see CHANGES for all):

Significant speedup achieved by both use of new fast aligner (minimap2) and the refactoring of alignment analyzing modules
New k-mer-based completeness and correctness metrics
BUSCO added for enhanced reference-free analysis
The concept of upper bound assembly (theoretical limits on the assembly completeness and contiguity for a given genome and set of reads)

Address of the bookmark: http://cab.spbu.ru/software/quast-lg/

LTR_Finder: an efficient program for finding full-length LTR retrotranspsons in genome sequences.

Neel — Sun, 13 Jan 2019 07:05:53 -0600

LTR_Finder is an efficient program for finding full-length LTR retrotranspsons in genome sequences.

The Program first constructs all exact match pairs by a suffix-array based algorithm and extends them to long highly similar pairs. Then Smith-Waterman algorithm is used to adjust the ends of LTR pair candidates to get alignment boundaries. These boundaries are subject to re-adjustment using supporting information of TG..CA box and TSRs and reliable LTRs are selected. Next, LTR_FINDER tries to identify PBS, PPT and RT inside LTR pairs by build-in aligning and counting modules. RT identification includes a dynamic programming to process frame shift. For other protein domains, LTR_FINDER calls ps_scan (from PROSITE, http://www.expasy.org/prosite/) to locate cores of important enzymes if they occur.

Address of the bookmark: https://github.com/xzhub/LTR_Finder