<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/43670?offset=1110</link>
	<atom:link href="https://bioinformaticsonline.com/related/43670?offset=1110" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/43997/tools-for-rna-classification</guid>
	<pubDate>Tue, 08 Nov 2022 03:39:11 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/43997/tools-for-rna-classification</link>
	<title><![CDATA[Tools for RNA classification]]></title>
	<description><![CDATA[<p><span>barrnap</span>&nbsp;-&nbsp;<a href="https://github.com/tseemann/barrnap" target="_blank">https://github.com/tseemann/barrnap</a></p><p><span>CPAT</span>&nbsp;-&nbsp;<a href="https://github.com/liguowang/cpat" target="_blank">https://github.com/liguowang/cpat</a>,&nbsp;<a href="http://lilab.research.bcm.edu/" target="_blank">http://lilab.research.bcm.edu/</a>&nbsp;(web server)</p><p><span>CPC2</span>&nbsp;-&nbsp;<a href="https://github.com/gao-lab/CPC2_standalone" target="_blank">https://github.com/gao-lab/CPC2_standalone</a>,&nbsp;<a href="http://cpc2.gao-lab.org/" target="_blank">http://cpc2.gao-lab.org/</a>&nbsp;(web server)</p><p><span>Infernal</span>&nbsp;-&nbsp;<a href="http://eddylab.org/infernal/" target="_blank">http://eddylab.org/infernal/</a>,&nbsp;<a href="https://github.com/EddyRivasLab/infernal" target="_blank">https://github.com/EddyRivasLab/infernal</a></p><p><span>NCBI RefSeq</span>&nbsp;-&nbsp;<a href="https://www.ncbi.nlm.nih.gov/refseq/" target="_blank">https://www.ncbi.nlm.nih.gov/refseq/</a></p><p><span>Rfam</span>&nbsp;-&nbsp;<a href="http://rfam.xfam.org/" target="_blank">http://rfam.xfam.org/</a>,&nbsp;<a href="https://docs.rfam.org/en/latest/index.html" target="_blank">https://docs.rfam.org/en/latest/index.html</a></p><p><span>SILVA</span>&nbsp;-&nbsp;<a href="https://www.arb-silva.de/" target="_blank">https://www.arb-silva.de/</a></p><p><span>RNAmmer</span>&nbsp;-&nbsp;<a href="http://www.cbs.dtu.dk/services/RNAmmer/" target="_blank">http://www.cbs.dtu.dk/services/RNAmmer/</a>&nbsp;(web server, standalone download link)</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/42972/list-of-bioinformatics-workflow-management-tools</guid>
	<pubDate>Sat, 20 Mar 2021 00:15:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/42972/list-of-bioinformatics-workflow-management-tools</link>
	<title><![CDATA[List of bioinformatics workflow management tools !]]></title>
	<description><![CDATA[<h3>Here are list of&nbsp;Workflow Managers</h3><ul>
<li><span><a href="https://github.com/pcingola/BigDataScript">BigDataScript</a></span>&nbsp;&ndash; A cross-system scripting language for working with big data pipelines in computer systems of different sizes and capabilities. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/25189778">paper-2014</a>&nbsp;|&nbsp;<a href="https://pcingola.github.io/BigDataScript">web</a>&nbsp;]</li>
<li><span><a href="https://github.com/ssadedin/bpipe">Bpipe</a></span>&nbsp;&ndash; A small language for defining pipeline stages and linking them together to make pipelines. [&nbsp;<a href="http://docs.bpipe.org/">web</a>&nbsp;]</li>
<li><span><a href="https://github.com/common-workflow-language/common-workflow-language">Common Workflow Language</a></span>&nbsp;&ndash; a specification for describing analysis workflows and tools that are portable and scalable across a variety of software and hardware environments, from workstations to cluster, cloud, and high performance computing (HPC) environments. [&nbsp;<a href="http://www.commonwl.org/">web</a>&nbsp;]</li>
<li><span><a href="https://github.com/broadinstitute/cromwell">Cromwell</a></span>&nbsp;&ndash; A Workflow Management System geared towards scientific workflows. [&nbsp;<a href="https://cromwell.readthedocs.io/">web</a>&nbsp;]</li>
<li><span><a href="https://github.com/galaxyproject">Galaxy</a></span>&nbsp;&ndash; a popular open-source, web-based platform for data intensive biomedical research. Has several features, from data analysis to workflow management to visualization tools. [&nbsp;<a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6030816">paper-2018</a>&nbsp;|&nbsp;<a href="https://galaxyproject.org/">web</a>&nbsp;]</li>
<li><span><a href="https://github.com/nextflow-io/nextflow">Nextflow</a>&nbsp;(recommended)</span>&nbsp;&ndash; A fluent DSL modelled around the UNIX pipe concept, that simplifies writing parallel and scalable pipelines in a portable manner. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/29412134">paper-2018</a>&nbsp;|&nbsp;<a href="http://nextflow.io/">web</a>&nbsp;]</li>
<li><span><a href="https://github.com/cgat-developers/ruffus">Ruffus</a></span>&nbsp;&ndash; Computation Pipeline library for python widely used in science and bioinformatics. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/20847218">paper-2010</a>&nbsp;|&nbsp;<a href="http://www.ruffus.org.uk/">web</a>&nbsp;]</li>
<li><span><a href="https://github.com/SeqWare/seqware">SeqWare</a></span>&nbsp;&ndash; Hadoop Oozie-based workflow system focused on genomics data analysis in cloud environments. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/21210981">paper-2010</a>&nbsp;|&nbsp;<a href="https://seqware.github.io/">web</a>&nbsp;]</li>
<li><span><a href="https://bitbucket.org/snakemake">Snakemake</a></span>&nbsp;&ndash; A workflow management system in Python that aims to reduce the complexity of creating workflows by providing a fast and comfortable execution environment. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/29788404">paper-2018</a>&nbsp;|&nbsp;<a href="https://snakemake.readthedocs.io/">web</a>&nbsp;]</li>
<li><span><a href="https://github.com/broadinstitute/wdl">Workflow Descriptor Language</a></span>&nbsp;&ndash; Workflow standard developed by the Broad. [&nbsp;<a href="https://software.broadinstitute.org/wdl">web</a>&nbsp;]</li>
</ul>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35057/ectools-long-read-correction-and-other-correction-tools</guid>
	<pubDate>Fri, 05 Jan 2018 04:02:22 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35057/ectools-long-read-correction-and-other-correction-tools</link>
	<title><![CDATA[ECTOOLS: Long Read Correction and other Correction tools]]></title>
	<description><![CDATA[<p>Long Read Correction and other Correction tools</p>
<p>This package is a loose collection of scripts. To run the correction<br>routine see the section below. Descriptions of the other scripts<br>are at the bottom of this file.</p>
<p>Contact: gurtowsk@cshl.edu</p>
<p>In short, the correction algorithm takes as input the unitigs from a short read assembly and uses them to correct long read data. More background information for the algorithm can be found:<br>http://schatzlab.cshl.edu/presentations/2013-06-18.PBUserMeeting.pdf</p><p>Address of the bookmark: <a href="https://github.com/jgurtowski/ectools" rel="nofollow">https://github.com/jgurtowski/ectools</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22786/ra-at-university-of-delhi</guid>
  <pubDate>Wed, 17 Jun 2015 20:35:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA at University of Delhi]]></title>
  <description><![CDATA[
<p>Research Scientist Jobs opportunity in University of Delhi on temporary basis</p>

<p>Qualifications : Ph. D.</p>

<p>Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics</p>

<p>No. of Post : 03</p>

<p>Department : Genetics</p>

<p>Salary : Rs. 60,000/-<br />How to apply</p>

<p>The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.</p>

<p>Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&amp;cntnt01articleid=5492&amp;cntnt01returnid=83</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36842/gap-filling-or-contigs-extensions-tools</guid>
	<pubDate>Fri, 01 Jun 2018 08:07:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36842/gap-filling-or-contigs-extensions-tools</link>
	<title><![CDATA[Gap filling or Contigs extensions tools !]]></title>
	<description><![CDATA[
<p>There are many tools to perform gap filling using Illumina short reads, for example "GapFiller: a de novo assembly approach to fill the gap within paired reads" or "Toward almost closed genomes with GapFiller". There are also some tools like GAPresolution that can help to perform local re-assemblies using 454 reads. We used GAPresolution but it is not a very good software, it is useful only in some specific situations.</p>

<p>Take a look at the PRICE software from the DeRisi lab. Its meant to do something very similar. http://derisilab.ucsf.edu/index.php?page=software</p>

<p>You could also look at SSPACE (http://www.baseclear.com/landingpages/basetools-a-wide-range-of-bioinformatics-solutions/sspacev12/), ATLAS tools (http://www.hgsc.bcm.tmc.edu/content/bcm-hgsc-software), and SCARPA (http://compbio.cs.toronto.edu/hapsembler/scarpa.html).</p>

<p>See the PAGIT protocol: http://www.sanger.ac.uk/resources/software/pagit/ </p>

<p>In particular, take a look at the IMAGE tool: http://genomebiology.com/2010/11/4/R41 </p>

<p>Also SOAPdenovo has ha function for scaffolding. Not sure about ABYSS</p>

<p>Here there is a useful explanation of several tools.</p>

<p>https://bioinformaticsonline.com/search?q=scaffolding&amp;entity_type=object&amp;entity_subtype=bookmarks&amp;offset=0&amp;search_type=entities</p>

<p>I could be wrong, but the above answers to your hypothetical scenario appear to miss the point that you aren't interested in assembling the full genome, just the 100 kb part you're interested in. I suggest the following algorithm:</p>

<p>1. Start with the initial assembly C0 of the contigs you have identified as overlapping your region of interest, and the set S of reads those contigs contain. Let C = C0.</p>

<p>2. Repeat:<br />a. Identify paired-end reads (not in C) for which one or both ends align within, or extending, contigs in C.<br />b. Identify unpaired reads that align extending these new paired-end reads.<br />c. Construct a new assembly C' from C and the new reads identified in (a) and (b).<br />d. Trim C' so it does not extend more than 100 kb to either end of C0. Set C = C'.<br />e. Let S' denote the reads that contribute to C'. If S' does not contain any reads not present in S, stop. Otherwise, Set S = S'.</p>

<p>3. If you don't have a complete assembly of the region of interest, generate an STS for each end of each contig, probe a library for clones including these STSes, subclone these clones into a paired-end sequencing vector, and generate paired-end reads for this library; then try steps (1) and (2) again, adding these new sequencing reads to what you had before.</p>

<p>4. If your average sequencing depth for the region of interest exceeds 25 or so without filling all gaps, it is likely that the remaining gaps represent sequences that are not getting cloned in your sequencing vectors. Try different sequencing vectors.</p>
]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</guid>
	<pubDate>Tue, 23 Jun 2015 10:39:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</link>
	<title><![CDATA[At what age did you gain passion in Bioinformatics?]]></title>
	<description><![CDATA[<p>Most of the bioinformatician were biologist ( yeah ... not all ;), and at later stage they gain a passion in Bioinformatics and learn it. When did you get inclined towards computational analysis of biological data?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38743/molinspiration-broad-range-of-cheminformatics-software-tools-supporting-molecule-manipulation</guid>
	<pubDate>Sun, 20 Jan 2019 05:32:40 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38743/molinspiration-broad-range-of-cheminformatics-software-tools-supporting-molecule-manipulation</link>
	<title><![CDATA[molinspiration: broad range of cheminformatics software tools supporting molecule manipulation]]></title>
	<description><![CDATA[<p><span>Molinspiration offers&nbsp;</span><a href="https://www.molinspiration.com/products.html">broad range of cheminformatics software tools</a><span>&nbsp;supporting molecule manipulation and processing, including SMILES and SDfile conversion, normalization of molecules, generation of tautomers, molecule fragmentation, calculation of various molecular properties needed in QSAR, molecular modelling and drug design, high quality molecule depiction, molecular database tools supporting substructure and similarity searches. Our products support also fragment-based virtual screening, bioactivity prediction and data visualization. Molinspiration tools are written in Java, therefore can be used practically on any computer platform.</span></p><p>Address of the bookmark: <a href="https://www.molinspiration.com/" rel="nofollow">https://www.molinspiration.com/</a></p>]]></description>
	<dc:creator>BioJoker</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22965/ra-bioinformatics-at-bharathidasan-university</guid>
  <pubDate>Sun, 28 Jun 2015 12:21:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at Bharathidasan University]]></title>
  <description><![CDATA[
<p>National Facility for Marine Cyanobacteria <br />Department of Marine Biotechnology <br />Bharathidasan University <br />Tiruchirappalli -620024, Tamil Nadu </p>

<p>Applications are invited from individuals who have high motivation to do research for the below mentioned position, </p>

<p>1. Research Associate - 1 No. <br />in the DBT sponsored project under the supervision of Dr. D. Prabaharan, Principal Investigator, National Facility for Marine Cyanobacteria, Dept. of Marine Biotechnology, Bharathidasan University, Tiruchirappalli-24. </p>

<p>Title of the Project: “Establishment of National Repository for Micro algae &amp; Cyanobacteria” funded by Department of Biotechnology, Govt. of India </p>

<p>Qualification </p>

<p>1. Research Associate – 1 No. Rs. 36,000/38,000/40,000 per month for I, II and III year + 20% HRA </p>

<p>Essential : Doctoral degree in relevant subject from recognized University/ Institutes <br />Desirable: Research experience in molecular biology and bioinformatics </p>

<p>Interested candidates can send their complete CV in plain paper with a passport size photograph, with details of Marks secured in all subjects from plus two stage (with proof, full postal address, sex, date of birth, community etc., along with additional qualification or experiences and two address of references whom could be contacted (One of whom should be PG teacher/guide). Application should reach the Principal Investigator on or before 30.06.2015 by Email (nfmcbic@yahoo.com)/Registered post/ Speed post, with subject subscribed as “Application for Research Associate /Technical Assistant /Lab attendant”. Qualifying candidates will be short listed and communicated with date of interview. No TA and DA will be given for attending the interview. Addressfor Communication Dr. D. Prabaharan Principal Investigator National Facility for Marine Cyanobacteria Bharathidasan University Tiruchirappalli-620024, Tamil Nadu.</p>

<p>Advertisement: http://www.bdu.ac.in/adv/NFMC_Project_Positions.pdf</p>
]]></description>
</item>

</channel>
</rss>